ID: 1134524416

View in Genome Browser
Species Human (GRCh38)
Location 16:14932998-14933020
Sequence CCACCCTGCCCAACCTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134524416_1134524418 -10 Left 1134524416 16:14932998-14933020 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134524418 16:14933011-14933033 GGCAGGGTGGTCCTGCCCCGTGG No data
1134524416_1134524421 5 Left 1134524416 16:14932998-14933020 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134524421 16:14933026-14933048 CCCCGTGGCCTCCTGCAGTGCGG No data
1134524416_1134524426 23 Left 1134524416 16:14932998-14933020 CCGTGGGAGGTTGGGCAGGGTGG No data
Right 1134524426 16:14933044-14933066 TGCGGCCCTCCCTGCCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134524416 Original CRISPR CCACCCTGCCCAACCTCCCA CGG (reversed) Intronic
No off target data available for this crispr