ID: 1134524552

View in Genome Browser
Species Human (GRCh38)
Location 16:14933599-14933621
Sequence CACCAAAGGCTGCTCGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134524544_1134524552 6 Left 1134524544 16:14933570-14933592 CCAGTGCTGCAGCCAGAGGGAAA No data
Right 1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG No data
1134524539_1134524552 22 Left 1134524539 16:14933554-14933576 CCAGGGCCGCCACTTTCCAGTGC No data
Right 1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG No data
1134524540_1134524552 16 Left 1134524540 16:14933560-14933582 CCGCCACTTTCCAGTGCTGCAGC No data
Right 1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG No data
1134524546_1134524552 -6 Left 1134524546 16:14933582-14933604 CCAGAGGGAAAGGCGTCCACCAA No data
Right 1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG No data
1134524541_1134524552 13 Left 1134524541 16:14933563-14933585 CCACTTTCCAGTGCTGCAGCCAG No data
Right 1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG No data
1134524538_1134524552 23 Left 1134524538 16:14933553-14933575 CCCAGGGCCGCCACTTTCCAGTG 0: 6
1: 1
2: 1
3: 16
4: 154
Right 1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG No data
1134524537_1134524552 28 Left 1134524537 16:14933548-14933570 CCATGCCCAGGGCCGCCACTTTC No data
Right 1134524552 16:14933599-14933621 CACCAAAGGCTGCTCGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134524552 Original CRISPR CACCAAAGGCTGCTCGGGAA GGG Intronic
No off target data available for this crispr