ID: 1134526765

View in Genome Browser
Species Human (GRCh38)
Location 16:14950436-14950458
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 9, 1: 0, 2: 18, 3: 14, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134526765_1134526774 -2 Left 1134526765 16:14950436-14950458 CCCCACCCAGTGGGGCCCCCATC 0: 9
1: 0
2: 18
3: 14
4: 289
Right 1134526774 16:14950457-14950479 TCTAATATTCTAAGTGTCAGAGG No data
1134526765_1134526777 23 Left 1134526765 16:14950436-14950458 CCCCACCCAGTGGGGCCCCCATC 0: 9
1: 0
2: 18
3: 14
4: 289
Right 1134526777 16:14950482-14950504 CCGTATTTGTAATAGCAAATGGG No data
1134526765_1134526775 22 Left 1134526765 16:14950436-14950458 CCCCACCCAGTGGGGCCCCCATC 0: 9
1: 0
2: 18
3: 14
4: 289
Right 1134526775 16:14950481-14950503 TCCGTATTTGTAATAGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134526765 Original CRISPR GATGGGGGCCCCACTGGGTG GGG (reversed) Intronic
900127567 1:1075329-1075351 GGGGGGTGCCACACTGGGTGGGG + Intergenic
900158201 1:1211905-1211927 GTTGGGGGCCCCGCTGGGCTGGG + Intronic
900176914 1:1295081-1295103 GCTGGGGGGCCCACTGCGGGGGG - Intronic
900278928 1:1852835-1852857 GAAGGGGGCGTGACTGGGTGTGG - Intronic
900294659 1:1942844-1942866 GAGGGGGGACCCAGAGGGTGTGG + Intronic
900366238 1:2313016-2313038 GGTGGGGGCCTCAATGGCTGGGG + Intergenic
900399702 1:2467891-2467913 GGTGGGGGCGCCAAGGGGTGGGG - Intronic
900464472 1:2818362-2818384 GCTGGGGGCCCCACTGCTTCAGG + Intergenic
900489276 1:2938810-2938832 TCTGGGGCCCCCACTGTGTGGGG + Intergenic
900977910 1:6028586-6028608 GCTGGTGGCCGCTCTGGGTGCGG + Intronic
901051780 1:6429033-6429055 GCTGGGAGCTCCCCTGGGTGGGG + Intronic
901314395 1:8296084-8296106 CATGGTGGCCCCACAGGCTGAGG + Intergenic
901331211 1:8410203-8410225 GAGGGGGGCCGCCCTGGCTGGGG + Intronic
902383913 1:16065607-16065629 GCTTGGGGCCACTCTGGGTGGGG - Intronic
902450043 1:16491110-16491132 GATGGTGACCCCCATGGGTGGGG + Intergenic
902555800 1:17245868-17245890 GGTCGGGGCCACACTGAGTGTGG + Exonic
902630490 1:17701728-17701750 GCTGGGCTCCCCACGGGGTGGGG - Intergenic
902776162 1:18676362-18676384 GATGGGGGCACGACAGGTTGGGG + Intronic
903879174 1:26497128-26497150 GATGGGGGCCGCCCTGGGGAAGG - Intergenic
904303649 1:29572889-29572911 GATGGAGGCTCCACTGTCTGAGG + Intergenic
904454220 1:30637436-30637458 GATGGAGGCTCCACTGTCTGAGG - Intergenic
905017257 1:34786214-34786236 GATGGGAGCACCACTGCCTGAGG - Exonic
910175169 1:84422262-84422284 TCTAGGGGCCACACTGGGTGAGG + Intergenic
912528366 1:110302146-110302168 AATGGGGGTCCCATAGGGTGAGG - Intergenic
914832992 1:151184384-151184406 GAAAGGGGCCCCACTGTGAGCGG - Exonic
916745480 1:167681906-167681928 GATGAGTTCCCCACTGGGAGGGG - Intronic
916979361 1:170116528-170116550 GATGAGGGCAGCAGTGGGTGTGG + Intergenic
917034216 1:170729294-170729316 GATGAGGTCCCCACAGAGTGTGG - Intronic
917335319 1:173919377-173919399 GATGGGGGTCTCACCGTGTGTGG - Intergenic
919878803 1:201889051-201889073 GCTGGGGGCTCCCCTGGGTAAGG + Exonic
921054620 1:211534545-211534567 GGTGGAGGCACCACTGGCTGGGG + Intergenic
921918657 1:220642131-220642153 GGAGGGGGACCCACTGAGTGAGG - Intronic
922764905 1:228151664-228151686 GCAGTAGGCCCCACTGGGTGTGG - Intronic
1063481202 10:6378155-6378177 GATGGGGGCAGCAGTGGGAGAGG - Intergenic
1064039015 10:11941701-11941723 GATGCAGGCCCCACTGGGGTGGG - Intronic
1065981492 10:30902744-30902766 GGTGGGAGATCCACTGGGTGAGG - Intronic
1067078143 10:43199613-43199635 GATCAGGGTCTCACTGGGTGTGG + Intronic
1067701476 10:48576152-48576174 TATGGGCTCCCCACTGGGTGTGG + Intronic
1067735702 10:48848592-48848614 GATTTGGGCCCCAGTGAGTGAGG + Intronic
1069745089 10:70709993-70710015 GATGGGGACCTGTCTGGGTGAGG + Intronic
1072744729 10:97932110-97932132 GATGGGGGGCCCAGTGAGTCTGG - Intronic
1073044006 10:100625549-100625571 GGTGGGGGCCCGAGAGGGTGGGG + Intergenic
1073115558 10:101089738-101089760 AGTGGGGGCCCCACTCGGGGAGG + Exonic
1074290315 10:112133336-112133358 GATGGGGGCCACGCTGGGCTGGG + Intergenic
1076144327 10:128105142-128105164 GTTGGGGTACCCACTGGGTCTGG + Exonic
1076449847 10:130549401-130549423 CAAGGGAGCCCCACTGTGTGAGG + Intergenic
1076798976 10:132811968-132811990 GCTGATGGCCCCACTGTGTGGGG - Intronic
1077228781 11:1449572-1449594 GATGGGGGCCCCAGTGGGGCTGG + Intronic
1083387507 11:62322556-62322578 GATTGGGCCCACACTGGGTGAGG - Intergenic
1084281769 11:68100847-68100869 GATGCGTGCACCACTGGGTCTGG - Intronic
1084429187 11:69101905-69101927 GATGGGGCCCTCTCTGGCTGTGG + Intergenic
1084736521 11:71108924-71108946 GGGGGGGGGCCCGCTGGGTGTGG - Intronic
1085309637 11:75508682-75508704 CATGGGGGCCACAGTGGGGGAGG - Intronic
1087407234 11:97745548-97745570 GGTGGGAGATCCACTGGGTGAGG - Intergenic
1088728137 11:112657434-112657456 CTTGTGGGCCCCCCTGGGTGTGG - Intergenic
1088879812 11:113964569-113964591 AATGGGGGCCTCACTGGATCAGG - Intergenic
1090869565 11:130731229-130731251 GATTGGGGCCCCGCTGGGTGTGG + Intergenic
1092218929 12:6700197-6700219 GATGGGGGCCACGCTGGGGCTGG - Exonic
1094458652 12:30668728-30668750 TATGGGGGCCCTACTGTGTGTGG - Intronic
1095984268 12:47989083-47989105 GATGGAGGGGCCAGTGGGTGGGG + Intronic
1097066957 12:56327693-56327715 GGTAGGGACCCCACTGGGTTAGG - Intronic
1102646416 12:114406698-114406720 TCTGGTGGCCCCACTGGGTGGGG - Intronic
1104104155 12:125643182-125643204 TGTGGTGGCCCCACTGGTTGAGG + Intronic
1104344578 12:127983812-127983834 GGTGCGGGATCCACTGGGTGAGG + Intergenic
1104414238 12:128584774-128584796 GCTGGGTGCTCCACTGGGCGAGG + Intronic
1104745282 12:131206794-131206816 GGTGGGGGCTCCACAGGGAGGGG - Intergenic
1104789055 12:131470312-131470334 GGTGGGGGCTCCACAGGGAGGGG + Intergenic
1104979167 12:132565735-132565757 GATGGGGGACACTCTGTGTGTGG - Intronic
1106588367 13:31076722-31076744 GATGGTTGCCTCACTGAGTGAGG + Intergenic
1107699784 13:43036318-43036340 GTTGAGGGCTGCACTGGGTGTGG - Intronic
1113902011 13:113802795-113802817 GCTTGGGGGGCCACTGGGTGGGG - Intronic
1115530984 14:34326970-34326992 GATGGGGGCCACACTGAATAAGG - Intronic
1116901041 14:50362322-50362344 GGTGTGGGATCCACTGGGTGAGG + Intronic
1118329102 14:64801977-64801999 GATGGGGGAGCCTCTGTGTGTGG - Intronic
1122983184 14:105200673-105200695 GATGGGGGTGTCCCTGGGTGGGG - Intergenic
1126379225 15:48029015-48029037 GATGGGATCCCCAGTGGATGAGG - Intergenic
1127849130 15:62897806-62897828 GGCAGGGGCCACACTGGGTGGGG - Intergenic
1128505939 15:68272788-68272810 CATAGGAGCCACACTGGGTGTGG - Intergenic
1130870734 15:87969913-87969935 GATGGCTGCCCCTTTGGGTGAGG - Intronic
1131283636 15:91040183-91040205 GATGGGGGCAGCACTGGGGAGGG - Intergenic
1132603243 16:783139-783161 GAGCAGGGCCCCAGTGGGTGGGG - Intronic
1134165880 16:11929037-11929059 ATCAGGGGCCCCACTGGGTGGGG + Intronic
1134494840 16:14724704-14724726 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134500223 16:14763824-14763846 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134526765 16:14950436-14950458 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134580356 16:15365226-15365248 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134645034 16:15858573-15858595 GATGGGGACCCCTCTGCTTGGGG + Intergenic
1134714342 16:16348913-16348935 GATGGGGGCCCCACTGGGTGGGG - Intergenic
1134722217 16:16392277-16392299 GATGGGGGCCCCACTGGGTGGGG - Intronic
1134945210 16:18319592-18319614 GATGGGGGCCCCACTGGGTGGGG + Intronic
1134952474 16:18359745-18359767 GATGGGGGCCCCACTGGGTGGGG + Intergenic
1135311273 16:21406451-21406473 ATCAGGGGCCCCACTGGGTGGGG + Intronic
1135364225 16:21838902-21838924 ATCAGGGGCCCCACTGGGTGGGG + Intronic
1135447618 16:22532446-22532468 ATCAGGGGCCCCACTGGGTGGGG - Intronic
1136150427 16:28344345-28344367 ATCAGGGGCCCCACTGGGTGGGG + Intronic
1136166664 16:28458183-28458205 ATCAGGGGCCCCACTGGGTGGGG + Intronic
1136196311 16:28656849-28656871 ATCAGGGGCCCCACTGGGTGGGG - Intronic
1136212652 16:28770974-28770996 ATCAGGGGCCCCACTGGGTGGGG - Intronic
1136257373 16:29050888-29050910 ATCAGGGGCCCCACTGGGTGGGG - Intronic
1136307977 16:29385447-29385469 ATCAGGGGCCCCACTGGGTGGGG + Intronic
1136321393 16:29486991-29487013 ATCAGGGGCCCCACTGGGTGGGG + Intronic
1136367043 16:29813680-29813702 GGGGGGGGCCCCATTGGCTGGGG - Exonic
1136436073 16:30226961-30226983 ATCAGGGGCCCCACTGGGTGGGG + Intronic
1137568323 16:49548151-49548173 CTTGGAGGACCCACTGGGTGAGG - Intronic
1138205292 16:55120175-55120197 GATGGGGGCAGCACTGGGGTGGG - Intergenic
1139855668 16:69977876-69977898 ATCAGGGGCCCCACTGGGTGGGG + Intergenic
1139942205 16:70613385-70613407 CATGGCGGCCACACTGGATGGGG + Intronic
1140129608 16:72148889-72148911 GATGTGGGCCCCATAGGGAGAGG - Intronic
1140367064 16:74390211-74390233 ATCAGGGGCCCCACTGGGTGGGG - Intronic
1141194598 16:81850985-81851007 GATGGGGTCCCCACTTGTTATGG + Intronic
1142308083 16:89296799-89296821 GGTGGGGGCCCCAGGGAGTGTGG + Intronic
1143090948 17:4448891-4448913 GATGGGGGCCTCCCAGGATGGGG + Intronic
1143134091 17:4701073-4701095 GATGGGGGCAGCATAGGGTGGGG + Intronic
1143499205 17:7329227-7329249 GGTGGGGGCCCCAGCGGGAGCGG - Exonic
1143527711 17:7482104-7482126 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1144443332 17:15303918-15303940 GCTAGGGACCCCACCGGGTGTGG - Exonic
1144664517 17:17092845-17092867 GTCGTGGCCCCCACTGGGTGAGG + Intronic
1144759196 17:17697856-17697878 GTTGGGGGCACCTCTGTGTGTGG + Intronic
1144762229 17:17713817-17713839 GATGGGGGATCCACTTGGAGGGG + Intronic
1145268151 17:21390311-21390333 GATGGAGGGCCCACTGGGATGGG + Intronic
1146731047 17:35194166-35194188 GCTGGTGGCCCTGCTGGGTGGGG - Exonic
1147318449 17:39632196-39632218 GTTTGGGGCCCCACAGAGTGGGG + Intronic
1147490348 17:40860224-40860246 GGTGGGGTCCCCACTGGGGCAGG - Intergenic
1147566830 17:41541624-41541646 GATGGAGGGCCCCCTGAGTGAGG + Intergenic
1148124932 17:45231609-45231631 GGTGGGGGCCCCTCTGGGGAGGG + Intronic
1151872134 17:76843613-76843635 GATGGGGTCTCAGCTGGGTGTGG - Intergenic
1152383469 17:79954668-79954690 GAAGGGGGCACCCATGGGTGCGG - Intronic
1152879363 17:82806602-82806624 GATGGGGGCCTCACAGGGAGGGG - Intronic
1152922529 17:83073130-83073152 GATAGGGGCCCAGCGGGGTGGGG - Intergenic
1154115454 18:11609715-11609737 GCTGGTGGCCCTGCTGGGTGGGG + Intergenic
1154117140 18:11621068-11621090 ATCAGGGGCCCCACTGGGTGGGG + Intergenic
1156473841 18:37393634-37393656 GGTGTGGGCTACACTGGGTGGGG + Intronic
1159359346 18:67381104-67381126 GCTGGGGGCTCCACTTGTTGGGG + Intergenic
1160825938 19:1080630-1080652 GGAGGGGGCCCCCCTGGCTGGGG + Intronic
1161270619 19:3387576-3387598 GCTGGGGGCCACTCTGGATGGGG + Intronic
1161327166 19:3669464-3669486 GGTGGGGACCCGGCTGGGTGTGG + Intronic
1161399208 19:4060038-4060060 GATGGGGCCCCGGGTGGGTGTGG - Intronic
1162194482 19:8973805-8973827 GATGGGGGCTCCAATGTGGGTGG - Exonic
1163268697 19:16236208-16236230 CATGGGGGCTCCACAGGGTGGGG - Intronic
1163758341 19:19120110-19120132 GATGGGGGCAGCGCTGGCTGAGG + Exonic
1164525291 19:29009003-29009025 GATGGGGGCTTCACTGGGAAGGG - Intergenic
1166154676 19:40901959-40901981 GATGGGGACCAGACTGTGTGGGG + Intergenic
1166173393 19:41048270-41048292 GATGGGGGCCAGACTGTGTGGGG - Intergenic
1167598223 19:50438393-50438415 GATGGGTGCCTCAGTAGGTGGGG + Intronic
926421441 2:12703747-12703769 AATAGTGGCCCCACAGGGTGGGG - Intergenic
927875649 2:26653625-26653647 GATGGTGGCCCCCTGGGGTGTGG - Intergenic
929075052 2:38074140-38074162 GGTCGGGGCACCGCTGGGTGGGG + Intronic
932126295 2:69148212-69148234 GGTGGGGTCCCCACTGTGGGAGG - Intronic
933603878 2:84360929-84360951 GTTGGGGGTCCCACTCAGTGAGG - Intergenic
935689560 2:105718549-105718571 GATGGGGGACACACTGGTTCTGG + Intergenic
936050334 2:109217833-109217855 GATGGGGGCTCCCCTGCCTGGGG - Intronic
937126616 2:119478752-119478774 GAGGGGTGTCCCTCTGGGTGGGG - Intronic
937294184 2:120799817-120799839 GATGTGGGCCTCACTGCCTGCGG + Intronic
937316927 2:120937594-120937616 GGTAGGGCCCCCAGTGGGTGGGG - Intronic
937884967 2:126893404-126893426 GCTAGGGGCCCCACTGGGCTTGG + Intergenic
937979656 2:127607461-127607483 GGCTGGGGCCCCAGTGGGTGAGG + Intronic
938501230 2:131832129-131832151 CATGCAGCCCCCACTGGGTGTGG - Intergenic
939933362 2:148258816-148258838 CATGGGGGCCCCCCTGTGGGTGG + Intronic
942099700 2:172567882-172567904 AATAGGAGCCCCACTGGGGGTGG - Intronic
942540166 2:177007927-177007949 GGTGGGCGCTCCACTGGGAGCGG + Intergenic
948438348 2:237968446-237968468 GATCGGGGCCCCTTTGGCTGGGG + Intronic
948792123 2:240384504-240384526 GATGGGGGCCCCACTCCTCGAGG + Intergenic
1168805866 20:672006-672028 GATGGGGGCCCCGGTCTGTGGGG + Intronic
1173163454 20:40669765-40669787 GATGGGGGCTGGACTGGGTTGGG + Intergenic
1174294981 20:49539539-49539561 CATGGGGGCCCCAGTGGGTGGGG - Intronic
1174353841 20:49985672-49985694 AATGGTGGGCCCAGTGGGTGGGG + Intronic
1175066186 20:56290729-56290751 GATGGGGGCACCCGTGGATGAGG + Intergenic
1175790640 20:61738058-61738080 GAGGTGGGCCCCAGAGGGTGGGG - Intronic
1175939866 20:62532966-62532988 GATGGGGGCTCTTCTGGGAGGGG - Intergenic
1175978453 20:62725341-62725363 GCTGGAGGCCCCACAGGATGAGG - Intronic
1176108389 20:63400017-63400039 GCTGGGGGCCACAGTGAGTGAGG - Intergenic
1179942472 21:44649028-44649050 GATGCGGGACCCACTGAGTCAGG + Intronic
1180037301 21:45256470-45256492 GATGGGGGCTCTGCTGGGTCGGG + Intergenic
1180056022 21:45359625-45359647 GATGGGGGCTGCTCTAGGTGGGG + Intergenic
1180084615 21:45502199-45502221 GATGGGGGGCCCTGGGGGTGTGG + Intronic
1180724084 22:17931455-17931477 GCTGGGAGCCCAACGGGGTGTGG + Intronic
1180825283 22:18857109-18857131 GATGGGGACCCCTCTGGGGATGG + Intronic
1180978782 22:19868903-19868925 GTGGGGGCCCCCAGTGGGTGGGG - Intergenic
1181313577 22:21958302-21958324 GAGGGTGGCACCACTGGCTGAGG + Intronic
1181346685 22:22224374-22224396 GAGGGTGGCACCACTGGCTGAGG + Intergenic
1181730592 22:24843482-24843504 GCTGTGGGTTCCACTGGGTGGGG + Intronic
1182618325 22:31603688-31603710 GAGGGTGCCCTCACTGGGTGGGG + Intronic
1182760391 22:32717875-32717897 GATGAGGCCGCCACGGGGTGAGG - Intronic
1182922433 22:34092158-34092180 AATGGGGGCACGGCTGGGTGGGG - Intergenic
1183305836 22:37082607-37082629 GATGGGGGCACCTCTGGGAACGG - Intronic
1183407637 22:37638337-37638359 GATGGGAGCCCACCTGAGTGTGG - Intronic
1183696712 22:39427865-39427887 GCAGGGGGCCCCACTGGGCTTGG + Intronic
1184092119 22:42298353-42298375 GTTGGGGCACCCATTGGGTGTGG + Intronic
1184754507 22:46508419-46508441 GGTGGGGGGGCCACAGGGTGGGG - Intronic
1185067201 22:48638469-48638491 GTTGGGGTCCCCCCTGTGTGCGG - Intronic
1185067214 22:48638508-48638530 GTTGGGGTCCCCCCTGTGTGTGG - Intronic
1185069070 22:48646502-48646524 GCTGGGGGCCCCTCTGTGGGTGG + Intronic
1185204913 22:49532311-49532333 GATGGGGACGCGCCTGGGTGGGG - Intronic
1185204924 22:49532348-49532370 GATGGGGACGCGCCTGGGTGGGG - Intronic
1185204935 22:49532385-49532407 GATGGGGACACGCCTGGGTGGGG - Intronic
1203215201 22_KI270731v1_random:2377-2399 GATGGGGACCCCTCTGGGGATGG - Intergenic
1203275432 22_KI270734v1_random:83012-83034 GATGGGGACCCCTCTGGGGATGG + Intergenic
950578976 3:13850595-13850617 GATGGGGGCCCAGCTGGGACGGG - Intronic
951038751 3:17965065-17965087 GTTGGGTGCCTCACTGGGTTAGG - Intronic
952491323 3:33876455-33876477 CATGGGGGCCCCTCTGGGCCTGG + Intergenic
953549031 3:43886207-43886229 GAGGGGTGCCCCATCGGGTGGGG + Intergenic
953881108 3:46691916-46691938 GAAGGGGGCTTCTCTGGGTGTGG + Intronic
955999393 3:64712627-64712649 GTCTGGGGCCCCACTGGGTCAGG + Intergenic
956629697 3:71304070-71304092 GATGAGGGCCCCAGAGGATGAGG - Intronic
960868510 3:122227147-122227169 GGTGCGGGATCCACTGGGTGAGG - Intronic
961118001 3:124348324-124348346 GCTGGGAGCCTCCCTGGGTGAGG - Intronic
961354508 3:126327492-126327514 GCTGTGGGCCACAGTGGGTGAGG + Intergenic
961380862 3:126495852-126495874 CATGGTGGCCACACTGGGAGGGG - Intronic
961666437 3:128495934-128495956 GATGTGGGGCCCTCAGGGTGGGG + Intergenic
961829455 3:129615991-129616013 CACAGGGGCTCCACTGGGTGCGG + Intergenic
965607598 3:170512276-170512298 GATGGGGGTTCCACTGGGAGGGG + Intronic
966269766 3:178090768-178090790 GGTGGGGGTCCCACTCAGTGAGG - Intergenic
966912259 3:184566152-184566174 GATGCTGGCCACACTGGGTCTGG - Intronic
967806938 3:193722888-193722910 GATGGGGGCATCACTGGTGGAGG + Intergenic
967807276 3:193727226-193727248 GATGTTGGCCCCACGAGGTGAGG + Intergenic
968276943 3:197447210-197447232 GACTGGGGCCCCAGAGGGTGTGG + Intergenic
968726015 4:2248168-2248190 GAGGGGTTGCCCACTGGGTGGGG - Exonic
968833595 4:2946790-2946812 GTTGGGGGCACCACTCTGTGTGG + Intronic
969020078 4:4134004-4134026 CATGTGGGCCCAACTGGGGGTGG + Intergenic
969081742 4:4624493-4624515 GCTGGGGGACCCAGGGGGTGAGG - Intergenic
969266624 4:6068294-6068316 GTCGGGGGCTCCACTGGGTCTGG - Intronic
969330387 4:6471148-6471170 GGTGGGTGCCCCAGTGGGAGGGG - Intronic
969423514 4:7110722-7110744 GATGGGGGCCACTCTGGGCTGGG + Intergenic
969733777 4:8973408-8973430 CATGTGGGTCCAACTGGGTGTGG - Intergenic
969793365 4:9507468-9507490 CATGTGGGCCCAACTGGGGGTGG - Intergenic
971563546 4:28112855-28112877 GGTGGGCGCCGCACTGGGAGTGG + Intergenic
973849269 4:54945309-54945331 GATGGAGGCACCCCAGGGTGGGG + Intergenic
982130341 4:152223774-152223796 GACTGGAGCTCCACTGGGTGAGG - Intergenic
985579638 5:689911-689933 GGTGGGGGATCAACTGGGTGGGG + Intronic
985579644 5:689927-689949 GGTGGGGGCTGCCCTGGGTGGGG + Intronic
985594484 5:781970-781992 GGTGGGGGATCAACTGGGTGGGG + Intergenic
985594490 5:781986-782008 GGTGGGGGCTGCCCTGGGTGGGG + Intergenic
985646880 5:1089166-1089188 GAGGGGGCTCCCTCTGGGTGTGG - Intronic
985680350 5:1252799-1252821 GATGGGGGCCCCAGCTGGGGTGG - Intergenic
985778326 5:1856948-1856970 AGTGGCGGCCCCTCTGGGTGGGG - Intergenic
986296824 5:6446339-6446361 CAGGGGGTCCCCGCTGGGTGTGG + Intergenic
990940719 5:61200537-61200559 CAAGGAGGCCCCACTGGTTGAGG + Intergenic
993794325 5:92248707-92248729 TATGAAGGCCCCACTGGGGGTGG - Intergenic
995518802 5:112980942-112980964 GATGGGGGCAATAGTGGGTGTGG - Intronic
997425710 5:133801347-133801369 GATGGTGGTGCCACTGGCTGAGG - Intergenic
997505813 5:134415858-134415880 GATGAGGGTCTCACTGTGTGTGG - Intergenic
997510062 5:134447911-134447933 GCTGGGAGGCACACTGGGTGGGG + Intergenic
998250973 5:140552136-140552158 GGTGGAGGCCCCATTGGGGGAGG + Exonic
999286791 5:150398955-150398977 GGTGGGGGCAGCAGTGGGTGGGG + Intronic
999736697 5:154518349-154518371 GATTGTGGCCCCATTGGCTGGGG + Intergenic
1001777127 5:174337346-174337368 CTTGGGGGCTCCACTGTGTGTGG + Intergenic
1002062605 5:176635010-176635032 GATCAGTGCCCCACTGGGTTTGG + Intronic
1002447536 5:179298474-179298496 GATCGGGGCGCCAGTGGGTTTGG - Intronic
1002639736 5:180625081-180625103 GAGGGTAGCCCCACTGGCTGTGG - Intronic
1002832622 6:836627-836649 CATGGGGCCCACGCTGGGTGGGG + Intergenic
1003308117 6:4946901-4946923 GGTGGGGGCCCTGCTGAGTGAGG - Intronic
1005811339 6:29518612-29518634 AATGGGGGGCCCTGTGGGTGGGG + Intergenic
1006284495 6:33082111-33082133 GAAGGTGGACACACTGGGTGGGG + Intronic
1006301172 6:33194189-33194211 GATGGGGGCCTCTCTGGAAGAGG - Exonic
1006788940 6:36686282-36686304 GATGATGCCCCCACTCGGTGAGG - Exonic
1006809300 6:36809779-36809801 GCTGGGAGCCCCACTGGCTGGGG - Intronic
1006907587 6:37543458-37543480 GAAGGGGGCCACAGTGCGTGTGG - Intergenic
1011728477 6:90234985-90235007 GATGGGTGCCCCAGTTGGTATGG - Intronic
1011823550 6:91280383-91280405 GATGGGGTCACCACTGCCTGGGG - Intergenic
1012979787 6:105817419-105817441 GCTGGGAGCCCCTCTGGGCGTGG - Intergenic
1013607310 6:111762214-111762236 GCTGGGGGCCACCCTGGGAGAGG + Intronic
1017685852 6:156913646-156913668 GATGGGGGCACCACGGGCTGGGG - Intronic
1017685975 6:156914060-156914082 AATGGGGGCACCACAGGCTGGGG - Intronic
1017686004 6:156914155-156914177 AATGGGGGCACCACAGGCTGGGG - Intronic
1017962115 6:159232334-159232356 GAGGGGGGCGCCCCTGGGCGGGG - Exonic
1018093286 6:160363447-160363469 GAGCGGGGCCCTCCTGGGTGAGG + Intronic
1018373290 6:163187633-163187655 GATGGGAAACCCACTGAGTGAGG - Intronic
1019280477 7:197325-197347 GGAGGGGGCTCCACTGGGAGGGG + Intronic
1019428767 7:989001-989023 GGTGGGGGTCCCACAGGGTCGGG - Exonic
1019513436 7:1429622-1429644 GTTGGGGGGCTCCCTGGGTGGGG - Intronic
1019579325 7:1752277-1752299 CATGGTGGCCCCTCTGGGTGGGG - Intergenic
1019723389 7:2587034-2587056 GATGGGGGCAGCAGTGGGTGTGG + Intronic
1023178791 7:37459867-37459889 TATGGGGGCCTCACTTGCTGTGG + Intergenic
1024903716 7:54352219-54352241 GGTGGTGGGCACACTGGGTGGGG + Intergenic
1026195947 7:68173920-68173942 GATGGGGGGCAGACTGGGGGAGG - Intergenic
1026928513 7:74210143-74210165 GCTCCTGGCCCCACTGGGTGGGG + Intronic
1027246871 7:76373547-76373569 GATGGGGGGCCCTCAGGGTCTGG - Intergenic
1028522493 7:91747509-91747531 CATGGTGGCCCCATTGGTTGAGG - Intronic
1029215080 7:98942264-98942286 GATGTGGACCCCACTTGGTCAGG - Intronic
1029550184 7:101233238-101233260 GATGGGGCTCCATCTGGGTGAGG - Intronic
1032819313 7:135510057-135510079 GATGGTGGCCCGTCTGGCTGTGG - Exonic
1033395751 7:140972219-140972241 GATGGGGGGAAGACTGGGTGTGG - Intergenic
1034192868 7:149224766-149224788 GTTGGGGGTCCCCCAGGGTGGGG + Exonic
1034279735 7:149844720-149844742 GCTGGTGGCACCACTGGGTATGG + Exonic
1034424932 7:151009388-151009410 GATGGTGGCCCTCCTGGGGGTGG - Exonic
1034731481 7:153391066-153391088 GATGGGTGGCCTACTGGGTGGGG + Intergenic
1034970156 7:155413667-155413689 GCTGGGAGCCCACCTGGGTGGGG + Intergenic
1035170855 7:157016787-157016809 GCTGGGGGCCCGCCTGGGAGGGG + Intergenic
1035433559 7:158840706-158840728 GATATGGGCCCCAGTGGGGGAGG + Intergenic
1035833896 8:2727911-2727933 GGTGGGCGCCCCACTCGGAGCGG + Intergenic
1035981839 8:4381286-4381308 GTTGGGGAAACCACTGGGTGGGG + Intronic
1036737488 8:11331226-11331248 GCTGGTGGCCCTGCTGGGTGGGG + Exonic
1037263766 8:17036749-17036771 GGTGCGGGATCCACTGGGTGAGG - Intronic
1037987287 8:23297927-23297949 GGTGGGGGCCGGGCTGGGTGAGG + Exonic
1039075803 8:33689602-33689624 GATGGGGGCTTCAGTGGGCGGGG - Intergenic
1049234917 8:141507686-141507708 GGTGGGCTCCCCTCTGGGTGCGG + Intergenic
1049678421 8:143903966-143903988 GCTGCGGGCCCTGCTGGGTGAGG - Intergenic
1053121160 9:35548267-35548289 TCGGGGGGCCCCACTGGATGAGG + Exonic
1057912891 9:99033988-99034010 AGTGTGGTCCCCACTGGGTGTGG + Intronic
1059494747 9:114700231-114700253 AATTTGGGACCCACTGGGTGTGG + Intergenic
1060304914 9:122402727-122402749 GGTTGGGGCCTCACTGAGTGTGG - Intergenic
1060965874 9:127712091-127712113 GATGGGGGCCCCTGTGGGCTTGG + Intronic
1061750399 9:132773039-132773061 GATGTGGGAGCCACTGTGTGGGG - Intronic
1061839316 9:133348392-133348414 GATTAGAGCCCCACTTGGTGTGG + Intronic
1062429151 9:136519277-136519299 GATGGGGGCCCCACTTCCCGTGG - Intronic
1062494129 9:136823668-136823690 GGTGGGTGCCCCAGTGGGTTCGG + Intronic
1062498427 9:136842389-136842411 GGTGCAGCCCCCACTGGGTGCGG + Intronic
1185469999 X:376534-376556 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470015 X:376595-376617 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470031 X:376656-376678 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470047 X:376717-376739 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470091 X:376892-376914 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470107 X:376953-376975 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470123 X:377014-377036 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470139 X:377075-377097 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470169 X:377193-377215 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470199 X:377311-377333 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470229 X:377429-377451 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470259 X:377547-377569 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470288 X:377665-377687 CATGGCGGCCCCACTGGGTGTGG - Intronic
1185470304 X:377726-377748 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470320 X:377787-377809 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185470335 X:377848-377870 CACGGCGGACCCACTGGGTGTGG - Intronic
1185470351 X:377909-377931 CATGGTGGCCCCACTGGGTGTGG - Intronic
1185550602 X:980602-980624 CATGGCAGCCCCAGTGGGTGAGG - Intergenic
1186501130 X:10051476-10051498 GTTGGGCGCCCCTCTGGGTTTGG + Intronic
1189742325 X:44132377-44132399 GATAGGGGACCAACTGGGCGCGG - Intergenic
1191717559 X:64204168-64204190 GAGGGGAGCCACACTGGGGGAGG + Intronic
1200258710 X:154600078-154600100 GTTGGGAGCCCCTCTGGGGGTGG + Intergenic