ID: 1134537254

View in Genome Browser
Species Human (GRCh38)
Location 16:15035824-15035846
Sequence ACCAACATGCTCCCCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134537254_1134537257 -3 Left 1134537254 16:15035824-15035846 CCCGGCCTGGGGAGCATGTTGGT 0: 1
1: 0
2: 1
3: 17
4: 226
Right 1134537257 16:15035844-15035866 GGTGTCAAGCTAGCAGCTCTCGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134537254 Original CRISPR ACCAACATGCTCCCCAGGCC GGG (reversed) Intronic
900106636 1:984236-984258 CCCGACTTGCCCCCCAGGCCCGG - Intergenic
900265146 1:1753512-1753534 GCCAACCTCCTCCCCGGGCCAGG - Intronic
900675031 1:3880193-3880215 ACCAGGAAGCTCACCAGGCCTGG - Intronic
900796271 1:4710586-4710608 CCCAACCTGCTTTCCAGGCCTGG + Intronic
900991021 1:6098415-6098437 CCCCACCTCCTCCCCAGGCCAGG + Intronic
901044348 1:6386457-6386479 TCCCACCTGCTCCCCATGCCAGG + Intronic
901761067 1:11471957-11471979 ACCACCATGCTCACCCGCCCTGG + Intergenic
901773809 1:11545380-11545402 ACTAGCACCCTCCCCAGGCCTGG + Intergenic
903036200 1:20494195-20494217 ACCCGAATGCTCCCTAGGCCTGG - Intergenic
903212750 1:21828016-21828038 GCCAACAAGGTACCCAGGCCTGG - Exonic
903361525 1:22780226-22780248 ACCCCCATTCTCCCCAGGTCAGG - Intronic
903861029 1:26364687-26364709 CCCAACCGACTCCCCAGGCCTGG - Exonic
903989264 1:27254299-27254321 ACCAGAATGCTAACCAGGCCAGG + Intronic
904012148 1:27395889-27395911 CCCAACAGGCCCCCCAGGCCTGG - Intergenic
906288219 1:44602340-44602362 AACTCCATGCTCCTCAGGCCAGG - Intronic
907157619 1:52348928-52348950 ACCCAGATGTTTCCCAGGCCAGG - Intronic
907372840 1:54014230-54014252 CCCATCATGCACCCCAGGTCAGG - Exonic
908154070 1:61334788-61334810 ACCATCAGCCTTCCCAGGCCTGG + Intronic
912048060 1:105485523-105485545 ACGAACATTCTCCCAAGGCTAGG - Intergenic
912475760 1:109933804-109933826 ACCAGCATGCTACCAGGGCCTGG + Intergenic
912858779 1:113194738-113194760 ACCCACATGCTTCCAGGGCCAGG + Intergenic
914393616 1:147243203-147243225 ACCAATAAACTCCCCAGGCCGGG - Intronic
914884677 1:151575089-151575111 ACCAGCTTCCTCCCCAGACCAGG - Intronic
916505418 1:165424216-165424238 ACTTAGATGCTCCCCAGGGCAGG + Intronic
916757848 1:167790374-167790396 ACCAACCTTCCCCCCAGGCAAGG + Exonic
917447656 1:175120190-175120212 ACCACTGTGTTCCCCAGGCCTGG - Intronic
917506407 1:175631017-175631039 ACCCACATCCTTCCCAGTCCTGG - Intronic
919822976 1:201484513-201484535 ACTAAAGGGCTCCCCAGGCCTGG - Exonic
920274192 1:204791884-204791906 ACCCACATCCACCCCAGGCTCGG - Intergenic
920526289 1:206669036-206669058 ACCAGAATGTTCCCCAGGTCGGG - Intronic
1065140434 10:22714349-22714371 ACCGCCGTGCTCCCGAGGCCGGG + Exonic
1066757259 10:38723351-38723373 CCCACCATTCACCCCAGGCCTGG - Intergenic
1066985642 10:42464393-42464415 TGCAATATGCTCCCCTGGCCTGG - Intergenic
1067081338 10:43214266-43214288 ACCCAGCTGCTGCCCAGGCCTGG - Intronic
1067390130 10:45856169-45856191 TGCAATATGCTCCCCTGGCCTGG - Intergenic
1067501339 10:46807689-46807711 TGCAATATGCTCCCCTGGCCTGG + Intergenic
1067593238 10:47532215-47532237 TGCAATATGCTCCCCTGGCCTGG - Intronic
1067640350 10:48040325-48040347 TGCAATATGCTCCCCTGGCCTGG - Intergenic
1068130574 10:52890241-52890263 ACCTAGAGGCTCCCCAAGCCAGG + Intergenic
1068283584 10:54908446-54908468 ACCTAGAAGCTCCCCAGGCCAGG - Intronic
1069907836 10:71742228-71742250 ACCCACTTGCTCCCTGGGCCAGG - Intronic
1071430483 10:85602786-85602808 CCCAACAGGCTGACCAGGCCTGG - Intronic
1071819273 10:89264062-89264084 ACCTAGAGGCTCCCCAAGCCAGG - Intronic
1073138733 10:101233980-101234002 GCCTCCCTGCTCCCCAGGCCTGG - Intergenic
1074346322 10:112689596-112689618 TCCATCATCCTCCCCAGGGCTGG - Intronic
1075274107 10:121078149-121078171 ACCAGCCTGCTCCCCGGGCAGGG + Intergenic
1076088178 10:127654263-127654285 CCCAACATTCACACCAGGCCAGG + Intergenic
1076615070 10:131749683-131749705 GCCCACCTCCTCCCCAGGCCTGG - Intergenic
1077134412 11:991429-991451 ACCATCATCCTCTCCAGACCAGG - Intronic
1079396476 11:20067915-20067937 GCCACCCTGCTCCCCAGGCGGGG - Intronic
1084942015 11:72617974-72617996 GCCACCATGCTCCCCAGGGCCGG + Intronic
1085313613 11:75530483-75530505 TCCAACCAGCTCTCCAGGCCAGG - Intergenic
1085350160 11:75793125-75793147 CCCAACACGATGCCCAGGCCCGG - Intronic
1085701742 11:78751981-78752003 ACCACCATTCTCTCCTGGCCTGG - Intronic
1085771141 11:79326855-79326877 ACCAAAATGCTCCATATGCCTGG - Intronic
1086259566 11:84922896-84922918 TCCAACATGCTCCCCCAGCGAGG + Intronic
1089202662 11:116733718-116733740 GCCAAGATTCTCCCCAGGCTGGG + Intergenic
1089479010 11:118790735-118790757 ACCGCCTTCCTCCCCAGGCCCGG + Intronic
1089702657 11:120254833-120254855 ACCAGCAAGCTCACCAGTCCAGG - Intronic
1090800977 11:130171941-130171963 ACCGACAGACTGCCCAGGCCAGG - Intronic
1091360823 11:134977479-134977501 ACCATCAGGCACCCCAGGCTGGG + Intergenic
1092160988 12:6315532-6315554 ACCAGCATTCTCCCCACCCCAGG + Exonic
1102264520 12:111471967-111471989 TAAAACATGATCCCCAGGCCAGG + Intronic
1103580113 12:121908596-121908618 ACCAAAGTGCTCCCAAGGCAAGG - Intronic
1104082787 12:125445672-125445694 AACAAGATGGTACCCAGGCCTGG - Intronic
1104477536 12:129083013-129083035 AACAACATGCTGGCCAGGCATGG - Intronic
1104990473 12:132621458-132621480 ACCCCCATTCTCCCCAGGCCGGG + Exonic
1107668312 13:42716054-42716076 AACACCATGAACCCCAGGCCAGG - Intergenic
1108342102 13:49507199-49507221 AAAAATATGCTCCCCAGGCCCGG - Intronic
1111093805 13:83482895-83482917 CCCAACATGCCTCCCAGCCCTGG - Intergenic
1112446500 13:99469348-99469370 ACCATCTGGCTCCCAAGGCCAGG + Intergenic
1112693181 13:101917815-101917837 CCAAATATGCTCCCCAGCCCTGG + Intronic
1113788569 13:113015628-113015650 GCCAGCCTGCACCCCAGGCCGGG + Intronic
1114072019 14:19119281-19119303 ACCAACTTGCTGCTAAGGCCAGG + Intergenic
1114090240 14:19280683-19280705 ACCAACTTGCTGCTAAGGCCAGG - Intergenic
1114372189 14:22102039-22102061 ACCACCATGTTCTCCATGCCTGG + Intergenic
1116313686 14:43359726-43359748 ACCAAGGGGCTCCCCAAGCCAGG - Intergenic
1119776093 14:77249663-77249685 ACCAACATGGTCCCCAGGTGTGG + Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121442846 14:93959573-93959595 ACCCACATCCTGCCGAGGCCAGG - Intronic
1121570907 14:94945808-94945830 ACCACCATGCTCCCCACCCCAGG - Intergenic
1122017117 14:98805659-98805681 CCCCACATGCTGCCCTGGCCTGG + Intergenic
1122126981 14:99584513-99584535 ACTACCTTGCTCCCCAGGCCTGG + Intronic
1122536346 14:102466176-102466198 ACCACCACACTCCCCAGGGCTGG - Intronic
1123001072 14:105294383-105294405 ACCACCATCCTCCCCCGGCAGGG + Intronic
1123450445 15:20356655-20356677 TCCAACGTCCACCCCAGGCCTGG + Intergenic
1124157928 15:27244369-27244391 CCCAGCATGCTCACCAGGCAAGG - Intronic
1124598609 15:31112500-31112522 TCCCAAATGCTCCCCAGTCCTGG + Intronic
1124619051 15:31263886-31263908 AGCCACATGCTAGCCAGGCCCGG + Intergenic
1128315229 15:66655617-66655639 ATCAAGATCCTCCCCAGCCCCGG + Intronic
1131350981 15:91699449-91699471 ACCCACATGCTCCCTAAGTCAGG + Intergenic
1132305405 15:100808261-100808283 ACTTAGAAGCTCCCCAGGCCAGG + Intergenic
1132850759 16:2023905-2023927 GCCAGCATGCTACCCAGGCGTGG - Intergenic
1133274259 16:4627104-4627126 ACCAAAATGCTGCTGAGGCCCGG - Intronic
1134065235 16:11224273-11224295 AGCAACAAGATCTCCAGGCCAGG + Intergenic
1134537254 16:15035824-15035846 ACCAACATGCTCCCCAGGCCGGG - Intronic
1134610165 16:15601628-15601650 TGCAACAGGCTCCCCAGGCTTGG + Intronic
1135391648 16:22098782-22098804 TCCACCATGCTCACCAGGCACGG + Intronic
1135435579 16:22424813-22424835 ACAGACAGGCTCCCGAGGCCTGG - Intronic
1136025927 16:27469187-27469209 ACCTTCAGGCTCCCCAGGCCAGG - Intronic
1136614949 16:31393079-31393101 ACCAACTGGCTCCTGAGGCCTGG + Intergenic
1136720265 16:32314374-32314396 CCCACCATTCACCCCAGGCCTGG + Intergenic
1136725316 16:32352767-32352789 CCCACCATTCACCCCAGGCCTGG + Intergenic
1136838641 16:33520650-33520672 CCCACCATTCACCCCAGGCCTGG + Intergenic
1136843647 16:33558824-33558846 CCCACCATTCACCCCAGGCCTGG + Intergenic
1137588727 16:49680513-49680535 ACCTAGAGGCTCCCCAAGCCAGG + Intronic
1137722452 16:50635359-50635381 ATCAACAAGCTCCCTTGGCCCGG - Exonic
1138434257 16:56988618-56988640 ACCCACACCCACCCCAGGCCTGG + Intergenic
1138533743 16:57648892-57648914 CCAAAAATGCTCCCGAGGCCAGG - Intronic
1138623669 16:58232093-58232115 ACCTCCAAACTCCCCAGGCCAGG + Intronic
1139378510 16:66515676-66515698 ACCCAGATGCTCCCCAAGCCTGG - Intronic
1139486198 16:67257893-67257915 CCCACCATGCTCCCCCAGCCTGG + Intronic
1141667449 16:85473230-85473252 TGAAACAAGCTCCCCAGGCCAGG - Intergenic
1141996296 16:87638454-87638476 ACCACCATGATCCACAGACCAGG + Intronic
1142044782 16:87918618-87918640 ACGGACAGGCTCCCGAGGCCTGG - Intronic
1142202614 16:88768316-88768338 TCCAAGAAGCTCCCCGGGCCAGG + Intronic
1203001115 16_KI270728v1_random:164987-165009 CCCACCATTCACCCCAGGCCTGG - Intergenic
1203006166 16_KI270728v1_random:203395-203417 CCCACCATTCACCCCAGGCCTGG - Intergenic
1203132717 16_KI270728v1_random:1701391-1701413 CCCACCATTCACCCCAGGCCTGG - Intergenic
1203148806 16_KI270728v1_random:1820936-1820958 CCCACCATTCACCCCAGGCCTGG + Intergenic
1203153812 16_KI270728v1_random:1859122-1859144 CCCACCATTCACCCCAGGCCTGG + Intergenic
1146175142 17:30661311-30661333 AACAACCAGCTCTCCAGGCCAGG + Intergenic
1147723577 17:42553347-42553369 ACCAACATGTTCCCAGGCCCAGG + Intronic
1149658447 17:58322595-58322617 TCCCACTTGCTCCCCATGCCAGG + Intronic
1151120452 17:71787140-71787162 ACCAACATGGTGCTCTGGCCCGG + Intergenic
1151569652 17:74919886-74919908 AACACCATGGTGCCCAGGCCGGG + Exonic
1151751851 17:76043627-76043649 ACCTAAATCCTCCTCAGGCCTGG + Intronic
1152079153 17:78175745-78175767 CCCACGAGGCTCCCCAGGCCGGG + Intronic
1152119913 17:78412126-78412148 CCCAGCATGCCCCACAGGCCAGG - Intronic
1152265844 17:79294217-79294239 ACGAACTTGCTCTCCAGTCCAGG - Intronic
1152337997 17:79708682-79708704 TCCAACGTCCACCCCAGGCCTGG - Intergenic
1152433048 17:80260364-80260386 ACCCGCATGCGCCCCACGCCTGG + Intergenic
1154494481 18:14945478-14945500 ACCATCAGGCACCCCAGGCTGGG - Intergenic
1155518451 18:26645542-26645564 ACAAGCATGCACCCCATGCCTGG + Intronic
1157384791 18:47251534-47251556 GCCGTCATTCTCCCCAGGCCGGG - Intergenic
1158352324 18:56575280-56575302 TCCAAAATGCTCCCCATCCCAGG - Intergenic
1159805301 18:72950175-72950197 ACCAACATGTTGCCAAGGTCAGG + Intergenic
1162362414 19:10227923-10227945 CACAGCGTGCTCCCCAGGCCTGG - Intronic
1162450532 19:10751607-10751629 ACCAACATTCACCCTCGGCCTGG - Intronic
1163158088 19:15449764-15449786 ACCCGCGGGCTCCCCAGGCCGGG + Intronic
1165140801 19:33698893-33698915 ACCCTCATACACCCCAGGCCTGG + Intronic
1165991529 19:39818027-39818049 TCTTACATGCTCCCCACGCCAGG + Intergenic
1166366604 19:42281212-42281234 CCCACCCTGCTCTCCAGGCCCGG - Intronic
1167511045 19:49895538-49895560 ACCAACAGGCGCCCCACCCCAGG + Intronic
926554633 2:14342308-14342330 ACCAAGGAGCTCCCCAAGCCAGG + Intergenic
926705319 2:15833462-15833484 ATCATCCTGCTCCCCTGGCCAGG + Intergenic
929589158 2:43134031-43134053 ACCGGCATGCTCCCCAGGACTGG + Intergenic
929949147 2:46393136-46393158 TCCAGCATGCTCCCCAGGCATGG + Intergenic
935187674 2:100748528-100748550 ACCAACAGGCTTCCCAGGCCAGG - Intergenic
940978022 2:159968594-159968616 ACTAACCTGTGCCCCAGGCCAGG - Intronic
947577429 2:231287033-231287055 ACAAACATCCTGCCCAGGGCTGG + Intronic
947991926 2:234495504-234495526 ACCAACATGCCCCCCAAGGTGGG + Exonic
948387440 2:237590461-237590483 ACTCACCTGTTCCCCAGGCCCGG + Exonic
948410385 2:237755230-237755252 ACCTAGCTGCTCCTCAGGCCTGG - Intronic
948800088 2:240429560-240429582 GCCAAAGTGCTCCCCAGACCTGG - Intergenic
1169261333 20:4140577-4140599 ACCAACTTGTTACCCAGGCTAGG - Intronic
1169437393 20:5604808-5604830 ACAGGCATGCTCCCCATGCCTGG - Intronic
1169751872 20:9002930-9002952 ACCTGCATGCTACCAAGGCCAGG - Intergenic
1170344307 20:15366589-15366611 ACCACCATACTCCCCAGCCTGGG - Intronic
1171042474 20:21778353-21778375 GCCAACATGCTCCCAAGTCCAGG - Intergenic
1172032178 20:31989906-31989928 TCCAAAATTATCCCCAGGCCAGG - Intronic
1175435561 20:58945057-58945079 ACCACCAATATCCCCAGGCCAGG - Intergenic
1179311296 21:40198439-40198461 ACCATCATCATACCCAGGCCAGG + Intronic
1180246011 21:46547809-46547831 ACAGACATGCACCCCACGCCTGG + Intronic
1180308813 22:11151851-11151873 CCCACCATTCACCCCAGGCCTGG - Intergenic
1180490460 22:15841636-15841658 ACCAACTTGCTGCTAAGGCCAGG + Intergenic
1180547290 22:16513662-16513684 CCCACCATTCACCCCAGGCCTGG - Intergenic
1181670947 22:24425191-24425213 TCCACCATGGTCCCCAGGGCTGG - Intronic
1182211876 22:28683672-28683694 CCCACCATTCACCCCAGGCCTGG + Intergenic
1183096089 22:35553169-35553191 ACCAAGAGGGTCCCCAGTCCTGG + Exonic
1183126474 22:35786641-35786663 AAGAACATGCACTCCAGGCCAGG - Intronic
1184257832 22:43297091-43297113 AACAACAGGGTCCTCAGGCCTGG - Intronic
1184683299 22:46084628-46084650 ACCAACATGCTGTCCACACCCGG - Intronic
1184970696 22:48017928-48017950 ACCTACATGCTCCCCAGCCAGGG + Intergenic
1185346154 22:50311736-50311758 CCCAACAGGCTGCCCAGGACAGG - Exonic
949756795 3:7421495-7421517 TCCCACATGGTCCACAGGCCTGG + Intronic
953773072 3:45793587-45793609 TCCTTCCTGCTCCCCAGGCCAGG - Intronic
954611971 3:51949273-51949295 TCCAACATGCAGTCCAGGCCAGG - Intergenic
956622928 3:71239251-71239273 ACCAAAAAGCTGCCCAGGCACGG + Intronic
957677799 3:83393090-83393112 TGCCACATGCTCCCCAGGTCTGG - Intergenic
961491724 3:127261112-127261134 GCCATCCTGCTTCCCAGGCCCGG - Intergenic
961514064 3:127422084-127422106 GGCAGCATGATCCCCAGGCCAGG - Intergenic
961654232 3:128432788-128432810 ACCCAGGTGATCCCCAGGCCAGG + Intergenic
962422249 3:135238983-135239005 ATCAACATGTTCCCCACGGCTGG - Intronic
966939754 3:184738358-184738380 ACCAACCAGCTCCCCAGCCCGGG + Intergenic
968068439 3:195771726-195771748 CCCAACAGGCTTCACAGGCCGGG - Exonic
968516180 4:1016565-1016587 CCCACCATGCTGCCCAGCCCTGG - Intronic
969263131 4:6046268-6046290 ACCAACATCCTCTCCAAGCTGGG + Intronic
969318710 4:6397315-6397337 ACCAAAAATCACCCCAGGCCAGG + Intronic
969614652 4:8245210-8245232 CACAGCCTGCTCCCCAGGCCGGG - Intergenic
969850203 4:9950024-9950046 AGCCACATGCTCCCCACCCCAGG - Intronic
970098825 4:12496926-12496948 AACAATATGCTCCCCACTCCGGG - Intergenic
971486966 4:27170464-27170486 AACAATATACTCCCCAGACCCGG - Intergenic
973206426 4:47565253-47565275 AAAAACATGCTAACCAGGCCGGG - Intronic
982097438 4:151935682-151935704 AGCAACATGCTTACCTGGCCAGG + Intergenic
986566807 5:9123917-9123939 CCCAACATGCTCACAAGGTCTGG + Intronic
986638837 5:9851722-9851744 ACCAATATGCTGCCCAGTACTGG + Intergenic
986722075 5:10566499-10566521 ACCACCAGGCTGCCCAGGACAGG - Intronic
986763439 5:10900739-10900761 TCCTACATGCTACCCAGCCCAGG - Intergenic
987222845 5:15808102-15808124 ACTCACATGCTCCTGAGGCCTGG + Intronic
990003899 5:50923329-50923351 ACCCACATTCGCGCCAGGCCTGG - Intergenic
990769505 5:59227013-59227035 AAGCACATGCTCTCCAGGCCAGG + Intronic
991996388 5:72391187-72391209 TTCAGCATCCTCCCCAGGCCTGG - Intergenic
993505833 5:88707705-88707727 ACCAAAATGCTGCCATGGCCAGG + Intergenic
994521737 5:100846788-100846810 ACCAATATGCTTCCCAGTTCTGG - Intronic
994679294 5:102865693-102865715 ACCAGCATTTTCCCCAGGCTTGG + Intronic
996370312 5:122746319-122746341 ATCAGCAGGCTCCCCAGGCTGGG - Intergenic
998140915 5:139698946-139698968 ACCAACATTTTCACCAGGCTGGG - Intergenic
1000081354 5:157850420-157850442 TTCATCATGCTCCCCAGGCTGGG - Intronic
1002181622 5:177433797-177433819 CCCAGCCTGCTCCCCAAGCCTGG - Intronic
1003498542 6:6685734-6685756 ACCTACAGGCTCCCAAGGCAGGG + Intergenic
1005303016 6:24489468-24489490 CCCAACATGATCAGCAGGCCAGG + Exonic
1007590348 6:43017151-43017173 AGCAACATGCCCCCCCGGCACGG - Exonic
1009413910 6:63395591-63395613 ACCAGCAGGAGCCCCAGGCCAGG - Intergenic
1013365731 6:109436367-109436389 TCCAAGTTGCTCCCCAGTCCAGG + Intronic
1016076679 6:139804582-139804604 ACCAAGAAGCTCCCCGAGCCAGG - Intergenic
1016210908 6:141532139-141532161 ACCGAAAAGCTCCCCAAGCCAGG + Intergenic
1017707621 6:157138375-157138397 ACAGACATGCACCCCACGCCGGG + Intronic
1017817826 6:158028030-158028052 CCCAAGATGCTCCCCCTGCCTGG - Intronic
1019478441 7:1255193-1255215 ACCAGAATGTGCCCCAGGCCAGG - Intergenic
1019560855 7:1656315-1656337 CTCATCATGCTCCCCAGGGCAGG - Intergenic
1020273879 7:6613631-6613653 AAAAACATGCTACCCGGGCCAGG - Intergenic
1021008145 7:15426456-15426478 ACCAAAATCTTCCCCAGGCGCGG + Intronic
1023634214 7:42193633-42193655 ACCCACATCCACCCAAGGCCTGG + Intronic
1026270609 7:68833246-68833268 ACCAACCTGCTGGCCAGGCGCGG - Intergenic
1026621327 7:71952353-71952375 ACCAACATCTTCCTCAGGCAAGG - Intronic
1026879482 7:73899765-73899787 TCAAACATGCACACCAGGCCCGG + Intergenic
1032023206 7:128421532-128421554 ACCAACAAGGTCTCAAGGCCTGG - Intergenic
1032053641 7:128666836-128666858 CTCAACATGGTGCCCAGGCCAGG + Intergenic
1034810039 7:154123915-154123937 ACAGACATGCTGCCCATGCCGGG + Intronic
1037715950 8:21400475-21400497 CAAAAAATGCTCCCCAGGCCTGG + Intergenic
1042336964 8:67639626-67639648 ACCTAGAAGCTCCCCAAGCCAGG - Intronic
1044021451 8:87110605-87110627 AGCAACATGCTCCGGAGGGCAGG - Intronic
1049377691 8:142296799-142296821 CCCCACAGGCTCCCCAGGACGGG + Intronic
1049606248 8:143530493-143530515 ACCAAGAAGCTCCCCAGCCTGGG + Intronic
1049798675 8:144507815-144507837 TCAGCCATGCTCCCCAGGCCAGG - Intergenic
1052743286 9:32414966-32414988 ACCCACAGACTCCCCAGGTCAGG - Intronic
1057718974 9:97517475-97517497 ACCACCACCCTCCCCTGGCCTGG - Intronic
1061070840 9:128309614-128309636 ACCAAGCAGCTCCCCAGTCCGGG - Exonic
1185648450 X:1631590-1631612 CCCAAGCTGCTCCCCAGGCAGGG - Intronic
1186610722 X:11135695-11135717 ACCAACATACCCCACAGGCCTGG + Intergenic
1186835704 X:13435668-13435690 ACATACTTGCTCCCCATGCCAGG + Intergenic
1195127590 X:101823216-101823238 ACCTGGATGCTCCCCAAGCCAGG + Intergenic
1197703928 X:129620242-129620264 AGCAACACTCACCCCAGGCCTGG - Intergenic
1197856377 X:130917794-130917816 ACCAACATGCTCCCCACCTGAGG - Intergenic