ID: 1134537814

View in Genome Browser
Species Human (GRCh38)
Location 16:15040743-15040765
Sequence TCCCCCCAGCACCCCAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134537814_1134537818 -5 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG 0: 1
1: 0
2: 0
3: 43
4: 483
1134537814_1134537820 13 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537820 16:15040779-15040801 CCAGGCACTTTCCCAGCTCCTGG No data
1134537814_1134537821 14 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537821 16:15040780-15040802 CAGGCACTTTCCCAGCTCCTGGG No data
1134537814_1134537828 28 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537828 16:15040794-15040816 GCTCCTGGGAAGGGTGGGCATGG No data
1134537814_1134537824 22 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537824 16:15040788-15040810 TTCCCAGCTCCTGGGAAGGGTGG No data
1134537814_1134537823 19 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537823 16:15040785-15040807 ACTTTCCCAGCTCCTGGGAAGGG No data
1134537814_1134537822 18 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537822 16:15040784-15040806 CACTTTCCCAGCTCCTGGGAAGG No data
1134537814_1134537825 23 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537825 16:15040789-15040811 TCCCAGCTCCTGGGAAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134537814 Original CRISPR TCCCCCCAGCACCCCAGGCC CGG (reversed) Intronic
No off target data available for this crispr