ID: 1134537818

View in Genome Browser
Species Human (GRCh38)
Location 16:15040761-15040783
Sequence GGGGAGAGGGAAACAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 483}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134537799_1134537818 28 Left 1134537799 16:15040710-15040732 CCTCCCCCAGAGCACTGGCAGGA No data
Right 1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG 0: 1
1: 0
2: 0
3: 43
4: 483
1134537801_1134537818 24 Left 1134537801 16:15040714-15040736 CCCCAGAGCACTGGCAGGAGAAA No data
Right 1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG 0: 1
1: 0
2: 0
3: 43
4: 483
1134537800_1134537818 25 Left 1134537800 16:15040713-15040735 CCCCCAGAGCACTGGCAGGAGAA No data
Right 1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG 0: 1
1: 0
2: 0
3: 43
4: 483
1134537802_1134537818 23 Left 1134537802 16:15040715-15040737 CCCAGAGCACTGGCAGGAGAAAA No data
Right 1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG 0: 1
1: 0
2: 0
3: 43
4: 483
1134537814_1134537818 -5 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG 0: 1
1: 0
2: 0
3: 43
4: 483
1134537816_1134537818 -10 Left 1134537816 16:15040748-15040770 CCTGGGGTGCTGGGGGGAGAGGG No data
Right 1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG 0: 1
1: 0
2: 0
3: 43
4: 483
1134537803_1134537818 22 Left 1134537803 16:15040716-15040738 CCAGAGCACTGGCAGGAGAAAAG No data
Right 1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG 0: 1
1: 0
2: 0
3: 43
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134537818 Original CRISPR GGGGAGAGGGAAACAAAACC AGG Intronic
900011477 1:114140-114162 GAGCAGGAGGAAACAAAACCAGG + Intergenic
900027580 1:290706-290728 GAGCAGGAGGAAACAAAACCAGG + Intergenic
900041538 1:470148-470170 GAGCAGGAGGAAACAAAACCAGG + Intergenic
900062972 1:705125-705147 GAGCAGGAGGAAACAAAACCAGG + Intergenic
901031181 1:6307846-6307868 GGGCAGAGGGAACCACAAACAGG + Intronic
901031193 1:6307906-6307928 GGGCAGAGGGAACCACAAACAGG + Intronic
901031207 1:6307984-6308006 AGGCAGAGGGAACCACAACCAGG + Intronic
901031305 1:6308475-6308497 AGGCAGAGGGAACCACAACCAGG + Intronic
901031331 1:6308589-6308611 GGGCAGAGGGAACTACAACCGGG + Intronic
901134208 1:6982649-6982671 GGGGACAGGGAGCCAGAACCCGG - Intronic
901494634 1:9613998-9614020 GGGGAGTGGGCAAGAGAACCAGG - Exonic
901759090 1:11459112-11459134 GGGAAAAAGGAAACAAAGCCTGG - Intergenic
902982356 1:20134105-20134127 GGAAAGAGGGAAACAGAACAGGG - Intergenic
903833062 1:26186182-26186204 TGGGAAGGGGAAAGAAAACCAGG + Intronic
904014036 1:27406749-27406771 GGGGAGCTGGAAACAGGACCTGG + Exonic
904493893 1:30876366-30876388 GGGAAGAGGGACAGAAAACGAGG - Intronic
904569730 1:31453982-31454004 GGGGGGAGGGCAAGAGAACCAGG + Intergenic
905292506 1:36932030-36932052 GGGGAGAGGGTAATGAATCCAGG - Intronic
905766819 1:40608308-40608330 AGGGGTAAGGAAACAAAACCAGG + Intergenic
905956851 1:42004158-42004180 GAGGAGAGGAAAACAAATCAAGG + Intronic
906074313 1:43040994-43041016 GGGGAGATGGAACCTGAACCTGG - Intergenic
906945005 1:50288055-50288077 GGGAAGAGGCAAACAAAAGTAGG - Intergenic
907442385 1:54487206-54487228 GGGGAGAGGAAGACAGAACTTGG - Intergenic
907646533 1:56250102-56250124 TAGGAGAGGAAAACCAAACCAGG - Intergenic
908729862 1:67214978-67215000 GGTCAGAGAGAAACAAAACAGGG - Intronic
909332177 1:74426627-74426649 GAGGTGAGGGAAACAAAACAAGG - Intronic
909540060 1:76781377-76781399 GGAGAGAGGGAAAGGAAGCCGGG - Intergenic
910226727 1:84943478-84943500 GAGGAGAAGCAAACAGAACCAGG + Intronic
910935669 1:92483586-92483608 CCTGAGAGGGAAAGAAAACCAGG + Exonic
911123570 1:94319705-94319727 GGGGAGGGGGACACAAAACTGGG - Intergenic
911157941 1:94655096-94655118 GGGGAGAGGGAGGCTAAACCTGG - Intergenic
911354263 1:96797043-96797065 GAGAAGAGGGAAATAAAGCCAGG + Intronic
911680512 1:100710094-100710116 AAGGAGAGGGAAACAAACCCCGG - Intergenic
911701538 1:100958826-100958848 AGGGAGGGGGAAACACAATCTGG + Intronic
912235189 1:107843697-107843719 GGGGAGAGGGTGAAAAAACTTGG - Intronic
912366819 1:109140526-109140548 GGGGAGAGGGGAGCAAAGCACGG + Intronic
912787530 1:112619146-112619168 GGGGAGAAGGACAGGAAACCGGG + Exonic
912832845 1:112969016-112969038 GGGGTGGGGCAAACAAAACATGG + Intergenic
913507163 1:119527365-119527387 GAGGAAAGGGAAAAAAAAGCAGG + Intergenic
913579720 1:120214128-120214150 TGGGAGAGGGAAAAAAGAACAGG - Intergenic
913628454 1:120684260-120684282 TGGGAGAGGGAAAAAAGAACAGG + Intergenic
914561654 1:148825555-148825577 TGGGAGAGGGAAAAAAGAACAGG - Intronic
914611178 1:149304653-149304675 TGGGAGAGGGAAAAAAGAACAGG + Intergenic
915563128 1:156699233-156699255 GAGGAGAGGGAAGCAACAGCTGG + Intergenic
915565911 1:156712593-156712615 AGGGAGAGGGAACCCACACCAGG - Intergenic
915744717 1:158146978-158147000 GGGGAGAGAGGTACAAAGCCTGG + Intergenic
916344944 1:163777109-163777131 GGGGAGAGGGATTCTATACCAGG + Intergenic
916518570 1:165543194-165543216 GGAGCGAGGGATAGAAAACCTGG - Intergenic
917482001 1:175420123-175420145 GGTGAGAGGCTACCAAAACCTGG - Intronic
919465243 1:197917479-197917501 GGGGGGAGGAAAACAAAATCTGG - Exonic
920266677 1:204729217-204729239 GTGGAGAGGGATTCAAACCCAGG - Intergenic
920304199 1:205008405-205008427 GGGGAGAGGCACACAACAGCAGG - Intronic
922259919 1:223930150-223930172 GAGCAGGAGGAAACAAAACCAGG + Intergenic
924341081 1:243032709-243032731 GAGCAGGAGGAAACAAAACCAGG + Intergenic
1062867754 10:871235-871257 GAAGAGAGGGAAACAAGCCCAGG - Intronic
1062989733 10:1804359-1804381 GGGGAGAGGAAAACAGCCCCTGG - Intergenic
1063688562 10:8261705-8261727 GGGGAGTGGGAAAGAAAGCATGG - Intergenic
1064138833 10:12773211-12773233 GGGAAGAGAGAAAGAAAACATGG - Intronic
1064288570 10:14013445-14013467 AGGGAGAGGGAAACAAAAGAGGG + Intronic
1066171317 10:32850065-32850087 TGGGATAAGGAAACAATACCAGG + Intronic
1066669916 10:37825913-37825935 GGGGAGAGAGAGAGAAAACTTGG + Intronic
1066735387 10:38472700-38472722 GAGCAGGAGGAAACAAAACCAGG - Intergenic
1067800106 10:49352933-49352955 GGGGAGAAGCAAACACAACTTGG - Intergenic
1067985534 10:51139604-51139626 GGGGAAAAGGAAACAACCCCAGG - Intronic
1068687179 10:59882073-59882095 GGGGAGAAGGAAAGGAAAGCCGG + Intronic
1068687187 10:59882096-59882118 GGGGAGAAGGAAAGGAAAGCCGG + Intronic
1068687201 10:59882142-59882164 GGGGAGAAGGAAAGGAAAGCCGG + Intronic
1068687247 10:59882315-59882337 GGGGAGAAGGAAAGGAAAGCCGG + Intronic
1068687279 10:59882430-59882452 GGGGAGAAGGAAAGGAAAGCCGG + Intronic
1068687292 10:59882476-59882498 GGGGAGAAGGAAAGGAAAGCCGG + Intronic
1068687325 10:59882591-59882613 GGGGAGAAGGAAAGGAAAGCCGG + Intronic
1071665369 10:87550716-87550738 GGGGGGAGGGGAACAGAGCCAGG - Intronic
1072247135 10:93553816-93553838 GGGGAGAGGAAAAGTAAACTGGG + Intergenic
1076534167 10:131166130-131166152 GGAGAGACGGAAGCAAAACCAGG + Intronic
1076967812 11:106376-106398 GAGCAGGAGGAAACAAAACCAGG + Intergenic
1077249119 11:1552971-1552993 TGGGAGAGGTATACTAAACCTGG + Intergenic
1078141532 11:8696730-8696752 GGGGAGAGGAAGACTACACCAGG - Intronic
1078406090 11:11071150-11071172 GAGGAGAGGAAAATAGAACCTGG - Intergenic
1079370266 11:19846540-19846562 TGGGAAATGGAAACACAACCCGG + Intronic
1079893578 11:26090178-26090200 GGGATGAGAGAAACAAAACAAGG + Intergenic
1079991414 11:27250465-27250487 GGGGAGAGGGAAAAAAAGGATGG + Intergenic
1080058695 11:27934077-27934099 GGGGAGAGGGAAACATTCCTGGG - Intergenic
1081311299 11:41576923-41576945 AGGGAGAGGGAAAGGAAAGCAGG - Intergenic
1081612566 11:44571296-44571318 GGGGAGTGGGGAAGAAAGCCTGG + Intronic
1083281957 11:61632423-61632445 GGGATGAGAGAGACAAAACCAGG - Intergenic
1083729103 11:64643379-64643401 GGGGGAAGGGAAGCAAATCCGGG + Intronic
1084768877 11:71329878-71329900 GGGGAGAAGGAGACAAGGCCAGG - Intergenic
1085395214 11:76203647-76203669 GGGGAGAGGGGATCAGAACCTGG - Intronic
1086028527 11:82324459-82324481 GGGGAGAGAGGAACAAAGCCTGG + Intergenic
1086362145 11:86069768-86069790 GAGTAGAGATAAACAAAACCAGG - Intronic
1086474553 11:87157823-87157845 AGGGAGAGGGAGAAAAAAGCTGG + Intronic
1088970116 11:114766564-114766586 AGGGAGAGGGAAGAAAAACTTGG - Intergenic
1091615884 12:2051501-2051523 GGGGAGAGGGAAGGTAGACCAGG + Intronic
1092673111 12:10885608-10885630 GAGGAGAGAGCGACAAAACCAGG - Intronic
1094394037 12:29985683-29985705 GGGGAGAGGGAGAGACAAACGGG - Intergenic
1094395906 12:30005664-30005686 GGGGAGAGGGAAGCCAGGCCTGG - Intergenic
1095246586 12:39930187-39930209 GGAGAGAGAGAAAAAAATCCTGG + Intronic
1095346200 12:41151428-41151450 GGGGAGTGGGGAATAAAAGCTGG - Intergenic
1095853023 12:46831304-46831326 GGGGAGAGGGAACCCGGACCCGG - Intronic
1096419825 12:51447601-51447623 GAGGAGATGGAGTCAAAACCAGG + Intronic
1097218311 12:57430923-57430945 GGGGAGAGGGGAAGAAAAGGGGG + Exonic
1097970700 12:65630070-65630092 GGGGAGTGGCAAAGAAGACCTGG + Intergenic
1098420075 12:70286063-70286085 TGGGAGAGGGGAGCAGAACCAGG + Intronic
1098597295 12:72289455-72289477 GGGGATGGGTAAACAAAACATGG - Intronic
1099231427 12:80030127-80030149 GGGGAGAGGACAACAATAACAGG - Intergenic
1099489085 12:83266053-83266075 TGGCAGAGAGAAACAAAACATGG - Intergenic
1099706073 12:86154296-86154318 GGGTAGACTGAAACAAAGCCCGG - Intronic
1099888087 12:88556394-88556416 GGAGAGAGGGCAACAAACCTGGG + Intronic
1101646976 12:106640421-106640443 GGTGAGAGGAAAACAACACTGGG + Intronic
1101802905 12:108037947-108037969 GGGGGCAGGGAAACAATAGCAGG - Intergenic
1102106946 12:110333389-110333411 TGGAAGGGGGAAACAAAATCAGG - Intronic
1102136751 12:110582428-110582450 GCGGAGAGGGAACCAGAACGAGG + Intronic
1102417744 12:112779201-112779223 GGGGAGAGGGAAAGAAGGCTGGG + Intronic
1102571692 12:113830710-113830732 GGGAAAAGGGAAAAAGAACCAGG + Intronic
1102840416 12:116113858-116113880 GGGGAGAGGGAGACAGAAGGGGG + Intronic
1102889137 12:116544533-116544555 GGGGAGAAGGAAGCAAAAGGTGG - Intergenic
1103416470 12:120745081-120745103 GGGGCGTGGGAAGGAAAACCTGG + Intergenic
1103884126 12:124188264-124188286 GAGGAGGAGGAAACCAAACCGGG - Intronic
1103890576 12:124235728-124235750 GGGGATAGGAAAAAAAAATCAGG + Intronic
1104028018 12:125043355-125043377 TGGGAGTGGAAAACAAAGCCTGG - Intergenic
1104732461 12:131115461-131115483 GGGTGGAGGGAGACAATACCAGG - Intronic
1105246243 13:18653140-18653162 GGACAGAGGGGAACAAAAACAGG - Intergenic
1105786868 13:23758824-23758846 GGTGGGAGGGAGAAAAAACCAGG + Intronic
1107695903 13:42999598-42999620 GGGGACAGAGGAACAAAGCCTGG - Intergenic
1108027424 13:46192667-46192689 GGGGGGAGGGTAAGAAAAACGGG + Intronic
1108159152 13:47619497-47619519 GGGGAGAGAGACAGAGAACCTGG - Intergenic
1108477102 13:50831132-50831154 GGGGAGAGGGAAAAAGAAAGGGG + Intronic
1110332427 13:74288070-74288092 GGGGGGAAGGAAAAAAAAACTGG + Intergenic
1112237433 13:97649038-97649060 GGGGAGAGGGAACCAACAGGGGG - Intergenic
1112545634 13:100366611-100366633 GAGGAGAGGGAAAGAAAAGGAGG - Intronic
1112806216 13:103166397-103166419 GGGAAGAAACAAACAAAACCAGG - Intergenic
1113141041 13:107149781-107149803 GGGAAGAGGTAAACAAAATGTGG - Intergenic
1114089279 14:19269905-19269927 GGGCAGAGAGAAACATAATCTGG - Intergenic
1114202009 14:20530066-20530088 GGAGAGAGGGAAACAGAAATTGG - Intergenic
1114415139 14:22537848-22537870 GGGGAGAGTGAAAGAAACCAGGG - Intergenic
1115119811 14:29926897-29926919 GGAGAGAGGGGAAGAAAACTGGG + Intronic
1116410706 14:44619764-44619786 GGGGAAAGGGAAAGAAATCAGGG - Intergenic
1117157214 14:52952175-52952197 GGGGAAGTGGAAACAAAAGCGGG - Intronic
1117395323 14:55303690-55303712 GGGGAGTGGGAAGCAAAATGAGG - Intronic
1118140961 14:63081883-63081905 GGGAAGAGGGAAGCAAACACCGG + Intronic
1118703860 14:68461797-68461819 GGGGAGAGGGACATAAAAGAAGG + Intronic
1119196746 14:72722857-72722879 GGGCAGAGGGGAAAAAACCCAGG - Intronic
1119511527 14:75215422-75215444 GGGGAGTGGGAAAAAAGATCGGG + Intergenic
1121243934 14:92449435-92449457 GGGTGGAGGGAAACTACACCAGG + Intronic
1121593334 14:95137396-95137418 GGGGAAAGGGAAAGAAAAAGGGG + Intronic
1121593375 14:95137526-95137548 GGGGAAAGGGAAAGAAAAAGGGG + Intronic
1122054163 14:99081277-99081299 GAAGTGGGGGAAACAAAACCTGG + Intergenic
1123065798 14:105618564-105618586 GGGGTGAGGGAGACAGCACCTGG - Intergenic
1123089196 14:105734597-105734619 GGGGTGAGGGAGACAGCACCTGG - Intergenic
1123094982 14:105762754-105762776 GGGGTGAGGGAGACAGCACCTGG - Intergenic
1123131390 14:105988424-105988446 GAGAAGAGGGCAACCAAACCAGG - Intergenic
1123160716 14:106275769-106275791 GGGAAGAGGCATATAAAACCAGG + Intergenic
1123581622 15:21719625-21719647 GTGAAGAGGGCAACCAAACCAGG - Intergenic
1123618271 15:22162248-22162270 GTGAAGAGGGCAACCAAACCAGG - Intergenic
1123627508 15:22238006-22238028 GGGAAGAGGGAGAGCAAACCGGG + Intergenic
1124031787 15:26018569-26018591 GGAGAGAGAGAAACTAAGCCTGG - Intergenic
1124184361 15:27510431-27510453 GGGGGAAGGGCAACAAAAACTGG - Intronic
1126107950 15:45159275-45159297 GAGCAGAGGGTGACAAAACCAGG + Intronic
1127930946 15:63597239-63597261 GGGGTGAGGGAAGAAAAGCCAGG - Intergenic
1128755753 15:70182584-70182606 GGGGAGAGTGAATCGAAACAAGG + Intergenic
1129746951 15:78028858-78028880 GGGGGAAGGGAAAAAAAGCCAGG + Intronic
1129776265 15:78238507-78238529 GGGGAGAGGGACAGAAAAGTGGG - Intronic
1129995824 15:80004182-80004204 GTGCAGTGGGAGACAAAACCAGG + Intergenic
1130533282 15:84764170-84764192 GTGGAGGGGTAAACTAAACCCGG + Intronic
1131240463 15:90737820-90737842 GGGCAGAGATAAACAAAACAGGG + Intronic
1131334371 15:91533475-91533497 GGGGACAGGGAACAAAACCCTGG + Intergenic
1131541521 15:93279154-93279176 GGGGAGAGGGATAGAAAAATTGG + Intergenic
1131632319 15:94191489-94191511 GGGAAGAGGGAGACAAAAGGAGG + Intergenic
1131978527 15:97971588-97971610 TTGGAGAGGGCAACAAAACAAGG + Exonic
1131999582 15:98165232-98165254 GGGGAGAGGGGAACCAAAGAGGG - Intergenic
1134093319 16:11403032-11403054 GGGGACAGAGGAAGAAAACCCGG - Intronic
1134537818 16:15040761-15040783 GGGGAGAGGGAAACAAAACCAGG + Intronic
1134824766 16:17275651-17275673 GTGTATAGGGAAATAAAACCAGG - Intronic
1135551355 16:23400592-23400614 GGAGAGAGGGAAAGAACAGCTGG + Intronic
1137406686 16:48194671-48194693 GGTGAAAGGGACAAAAAACCAGG - Intronic
1137924107 16:52523223-52523245 GGGCAGAGGAAAACAGGACCTGG + Intronic
1139644149 16:68315786-68315808 GGGGAAGGGGAGACAAAAGCGGG - Intronic
1140089453 16:71825703-71825725 ATGGATAGGGAAACAAAATCTGG - Intergenic
1140478462 16:75250504-75250526 GGGGTGTGGGAAAGGAAACCAGG + Intronic
1140954559 16:79849880-79849902 GCTGAGAGGGACACAGAACCAGG - Intergenic
1141338360 16:83178861-83178883 GGGGAGAGTGAACCAAACACTGG - Intronic
1141662481 16:85448945-85448967 GGGGAGAGGCAAACAGCTCCTGG - Intergenic
1141896837 16:86963726-86963748 GGGTAGAGGTATACACAACCCGG - Intergenic
1142116165 16:88357195-88357217 GGGGAGTGGGATTCAAACCCGGG - Intergenic
1142452868 16:90192763-90192785 GAGCAGGAGGAAACAAAACCAGG - Intergenic
1142478699 17:204892-204914 GGGAAAAGGGAACCAAAAGCTGG - Intergenic
1143673154 17:8410887-8410909 GGTGAGAGAGAAGCAAATCCAGG + Intergenic
1144578098 17:16442567-16442589 GGGGAGAGGGAGAAACAAACTGG - Intronic
1145756581 17:27396230-27396252 GGGGAAGGGGAAGCAAAACATGG + Intergenic
1146371435 17:32267121-32267143 GGGGAGATGGAAGTGAAACCAGG + Intronic
1146652167 17:34613641-34613663 GGGGAGAGGGAGAGAAAGCTAGG - Intronic
1146941160 17:36845411-36845433 GGGGAGAAGGAAAGAGAATCAGG + Intergenic
1147699883 17:42387356-42387378 GAGGAGAGGGAAACAAAGACAGG - Intronic
1147996260 17:44362040-44362062 GGGGCTGGGGAAACAAAACTGGG + Intronic
1148385223 17:47229538-47229560 GGGGAGAGGGAAGCAGCACTGGG - Intergenic
1149667204 17:58373350-58373372 GGTGGAAGGGAAAAAAAACCTGG + Intronic
1150252862 17:63718309-63718331 GGTGAGAGAGATACACAACCAGG + Intronic
1150601982 17:66659048-66659070 GAGGAGAGGGAAACAAAGAGAGG - Intronic
1151342249 17:73479262-73479284 GGGGAGAGGGAAGGAAATCTGGG - Intronic
1151822264 17:76502620-76502642 GTGCAGAGAGGAACAAAACCAGG + Intergenic
1151997876 17:77622046-77622068 GGGTTGAGGAAAACAAAAACAGG - Intergenic
1153173322 18:2341335-2341357 GGGGAGAGGTCAACAGAACCAGG - Intergenic
1153307924 18:3649760-3649782 AGGGAGAGGGAAACAAAGAGGGG + Intronic
1154442620 18:14405979-14406001 GGAAAGAGGGGAACAAAAACAGG + Intergenic
1155402931 18:25458469-25458491 GGGGAGGGGGGAAGAAATCCTGG + Intergenic
1155483286 18:26313001-26313023 GGAGAGAGAAATACAAAACCAGG - Intronic
1156253966 18:35377409-35377431 TGGGACAGGGAAAGAGAACCGGG + Intergenic
1156457825 18:37304679-37304701 GGGGTGAGGAGAACAGAACCAGG + Intronic
1156584896 18:38421161-38421183 TGGGAAAGTGAAACAAAACCTGG - Intergenic
1157151040 18:45218387-45218409 GGTGAGAGAGAAACAAAATGTGG - Intronic
1159827998 18:73238762-73238784 GAGGAGAGGAAAACATAACCTGG - Intronic
1160644617 19:175999-176021 GAGCAGGAGGAAACAAAACCAGG + Intergenic
1161037548 19:2093812-2093834 GGGGAAAGGGAAACACATCCAGG + Intronic
1161582471 19:5088353-5088375 GGGGAGTTGGAGACAAAGCCCGG - Intronic
1162018140 19:7856652-7856674 GGGGTGAGGGCAACCAAATCCGG - Intronic
1162092074 19:8286829-8286851 GGGGGGAGGGAAAAAAAAGAGGG + Intronic
1162340306 19:10087660-10087682 GGGGAAAGGGAAAGAAAGGCAGG + Intronic
1162847902 19:13407952-13407974 GGGGGGAGTGCTACAAAACCAGG - Intronic
1163152307 19:15422683-15422705 GGAGAGAGGGAACCAGAACAGGG + Exonic
1163822139 19:19502142-19502164 GGAGAGAGTGAAACAGAAACAGG - Intronic
1163976552 19:20858523-20858545 GGGTCTAGGGAAAGAAAACCAGG + Intronic
1166281035 19:41793504-41793526 GGGGAGAGGGAAAAAAGAAATGG + Intergenic
1167028608 19:46941047-46941069 TGGGAGAGGGAAAAAAAAGGAGG - Intronic
1167687568 19:50966198-50966220 TGGGAGAGGGAAAGAGAAACAGG - Intronic
1168288249 19:55345049-55345071 GGGGGGATGGAAACAAAAGGCGG + Intronic
1168325543 19:55536881-55536903 AGGGTGAGGGAAACAGAATCAGG - Intronic
925112871 2:1351664-1351686 GGTGACAGAGAAACAAACCCAGG - Intronic
925389222 2:3484198-3484220 GGGGAGAGGGGTTCAAAACGTGG - Intronic
925889702 2:8423720-8423742 GGGGAGGGGGAACCAAAAGAGGG + Intergenic
926147090 2:10403154-10403176 GGGGAGAGGGACACCAGTCCTGG + Intronic
926728384 2:16015558-16015580 GGGGATGGGGTAACAAAACAGGG - Intergenic
926825433 2:16901441-16901463 GTGGGGAGGGAACCATAACCAGG - Intergenic
927526165 2:23743006-23743028 TAGGAGAAGGAAACAAAATCAGG + Intergenic
929282508 2:40096572-40096594 GGGAAGAGGGAAAAACATCCAGG - Intergenic
929890145 2:45912129-45912151 GGGGAGAGAAGAACAATACCAGG + Intronic
930948913 2:57112948-57112970 GGGTAGAGGGAAACATTAGCTGG - Intergenic
931060377 2:58522253-58522275 GGGGAGAGAGAAAGCAAAGCAGG + Intergenic
931446603 2:62332090-62332112 TGGGGGAGGGAAAGAAAACCTGG + Intergenic
932612937 2:73213185-73213207 GGGGACAAGGAAACAAAACAAGG + Intergenic
933354076 2:81193772-81193794 AGGCAGAGGGACACAGAACCAGG - Intergenic
933585996 2:84179984-84180006 GGGGAGATGGAAAGAAAAAGGGG + Intergenic
933784798 2:85829990-85830012 TGGGAGAGGGAAAGAAAATCAGG + Intergenic
933942000 2:87252839-87252861 GGGGTGAGGGGAACAAAAGGTGG - Intergenic
934109965 2:88733272-88733294 GGGGAGAGGGAAAGCAAAGCTGG + Intronic
934516345 2:94990252-94990274 GGGGAAAAGGCAACAAAACTAGG + Intergenic
934771775 2:96912109-96912131 GGGGAGAGACAAAGGAAACCAGG + Intronic
935089388 2:99880281-99880303 GGGGCGCGTGACACAAAACCAGG - Intronic
935305449 2:101732453-101732475 GGGGAGCGGGGAATGAAACCGGG - Intronic
935698030 2:105786793-105786815 AGGCAGAGGGGAACAAACCCAGG - Intronic
936152652 2:110030146-110030168 GGGGAGACAGAAAGAAACCCAGG + Intergenic
936192028 2:110341266-110341288 GGGGAGACAGAAAGAAACCCAGG - Intergenic
936338222 2:111608731-111608753 GGGGTGAGGGGAACAAAAGGTGG + Intergenic
936981654 2:118270393-118270415 GGCAAGAGGGAAAATAAACCTGG - Intergenic
937220961 2:120343257-120343279 GGGCAGATGCAAGCAAAACCAGG + Intergenic
937240103 2:120454714-120454736 GGAGACAGAGAAACAAACCCTGG + Intergenic
937316119 2:120933092-120933114 GGGGAGAGGGGAGCAGGACCAGG + Intronic
937517777 2:122674818-122674840 GGGTAGAGAGAAAGAAAACTTGG + Intergenic
937830029 2:126409493-126409515 GGGGAGAGGAAAAAAATACACGG + Intergenic
939304999 2:140400446-140400468 GGGGAGTGGGGAAGTAAACCAGG - Intronic
939440690 2:142245374-142245396 GGGGAAAGAAAAAAAAAACCAGG + Intergenic
941486201 2:166085605-166085627 GGGGAAAGAGAAACAGATCCAGG + Intronic
942449803 2:176101663-176101685 AGGGAGAGGGAAAAATATCCAGG + Intergenic
942628200 2:177926746-177926768 GAGTAGAAGGAAAAAAAACCAGG - Intronic
945577358 2:211548688-211548710 GGGGAAACGGAAACATAAGCAGG - Intronic
945737644 2:213620163-213620185 GGGAAGAGGGAAAGAAAAAAAGG + Intronic
946201485 2:218073184-218073206 GGGCAGGGGGAAACAGCACCAGG + Intronic
946977056 2:225164674-225164696 GGTGAGAGGGAAACAGAGACAGG + Intergenic
946998502 2:225424834-225424856 GAGAAGATGGAAACAAAATCTGG - Intronic
948783009 2:240336161-240336183 GAGGAGAGGGAAGCAGAGCCTGG - Intergenic
949084308 2:242137426-242137448 GAGCAGGAGGAAACAAAACCAGG - Intergenic
1168827170 20:821768-821790 GGAGGGAGGGGAACAAAAACAGG - Intergenic
1169297720 20:4414367-4414389 GGGGAGAGGGAATAAAAAAAGGG - Intergenic
1169652656 20:7886908-7886930 GATGAGGGGGAAACAATACCTGG - Intronic
1169685965 20:8272129-8272151 GGGTGGAGGGAAAGAAAAACTGG + Intronic
1170281981 20:14659583-14659605 GGGTAGAGAGAAAAAAAACTGGG - Intronic
1171997121 20:31740102-31740124 GGGGGAAGGAAAACCAAACCAGG + Intronic
1172689867 20:36782982-36783004 GGGGAGAGGGAGAAAGAGCCTGG + Exonic
1173467210 20:43292773-43292795 GGAGAGAGGGAAACAGGACAAGG + Intergenic
1173498078 20:43533455-43533477 GTGGAGAGGGAAGCAGAGCCAGG - Intronic
1173528247 20:43749343-43749365 GAGGGGATGAAAACAAAACCAGG - Intergenic
1173698279 20:45042490-45042512 TGGGAGAGGGAAATGACACCAGG - Intronic
1174454984 20:50642573-50642595 GGGGAGATGGAGACATACCCTGG - Intronic
1176280891 20:64309909-64309931 GAGCAGGAGGAAACAAAACCAGG - Intergenic
1176453464 21:6885214-6885236 GGAAAGAGGGGAACAAAAACAGG - Intergenic
1176519928 21:7816899-7816921 GGGGAGAGGGAAAAGTAACCGGG - Exonic
1176742439 21:10616696-10616718 GGGGAGGGGGACAAAAACCCGGG - Intergenic
1176831639 21:13750262-13750284 GGAAAGAGGGGAACAAAAACAGG - Intergenic
1177083479 21:16672169-16672191 GGGGACAGAGAAAAACAACCTGG - Intergenic
1177749844 21:25267029-25267051 GGGGAGGGGGAAAGAGAAACAGG + Intergenic
1178653956 21:34446912-34446934 GGGGAGAGGGAAAAGTAACCGGG - Intergenic
1178868528 21:36351441-36351463 GGGGAGAGGGAAATAAAGAGGGG - Intronic
1180666384 22:17516166-17516188 GAGGAGAGGGACAGATAACCAGG + Intronic
1181317264 22:21978785-21978807 GGGGTGAGCTCAACAAAACCTGG + Intronic
1182097598 22:27636659-27636681 GGGCAGAGGGAAACAAACAAGGG + Intergenic
1182749085 22:32627302-32627324 GGGAGGAAAGAAACAAAACCAGG + Intronic
1184489874 22:44802384-44802406 GGCTAAAAGGAAACAAAACCTGG - Intronic
1184624167 22:45709903-45709925 GGTGAGAGTGAAAGAAAATCAGG - Intronic
949322993 3:2832423-2832445 GGGGTGAGGGAAAGGAAAACAGG + Intronic
950413008 3:12851169-12851191 GTGGAGAGAGAAGCAAAGCCGGG + Intronic
950915027 3:16636223-16636245 GGAGAGAGTGAAGCAAAACAAGG + Intronic
953073594 3:39547484-39547506 GGAGAGAGGGAAAAAAGACTGGG + Intergenic
953232131 3:41074644-41074666 GGGAAGAGGAGAACAAAGCCAGG - Intergenic
953925827 3:46982004-46982026 GGGGCCAGGCAAACAAATCCAGG + Exonic
955191503 3:56766020-56766042 ATGGATAGGGAAAAAAAACCAGG - Intronic
956553361 3:70488062-70488084 CGGGAGGGGGATACAAAACTCGG - Intergenic
956759007 3:72420943-72420965 GGAGAGAGGGTAACAAAATATGG + Intronic
956870740 3:73415170-73415192 TGAGAGAAGGAAAGAAAACCTGG + Intronic
957003695 3:74918093-74918115 TGTGAGAGGGAAAAAAAAACTGG - Intergenic
957424037 3:80012387-80012409 TGGGAGAGGGAATGACAACCAGG - Intergenic
957879491 3:86192665-86192687 TGGGAGAGGGAGAGAAAAGCAGG - Intergenic
958707901 3:97679202-97679224 GGGGAAAGAGAAGTAAAACCTGG - Intronic
960935293 3:122896307-122896329 GGGGACAGGGAGACAAAACAGGG - Intergenic
961093215 3:124133256-124133278 GGGAAGAGGGAATCAAATCTGGG + Intronic
961155945 3:124679911-124679933 GAGGAGGGGAAAACAAAAGCGGG - Intronic
961413650 3:126741923-126741945 AGGGAGAGGGAGACAAAGCAGGG - Intronic
961418689 3:126782026-126782048 GGGGAGAGGGAAAAGAAGACTGG + Intronic
961671931 3:128538934-128538956 CGGGAGAAGGAAAGAAAACTTGG - Intergenic
961734619 3:128993724-128993746 GGGGAGAGGCAAACCAGGCCGGG + Intronic
962292213 3:134146337-134146359 GGGGTGAGAGAAAGAAAACAAGG + Intronic
963064350 3:141251838-141251860 GGGGAGAGGGAACAAAGACAAGG + Intronic
963300901 3:143596095-143596117 GATGAGAGGGAAACAAACCAGGG + Intronic
963640299 3:147853299-147853321 AAGGAGAGGGAAAGAAAAGCAGG + Intergenic
964002089 3:151787186-151787208 GGGGAGAGAGAGAGAAAACCTGG - Intergenic
964246070 3:154655339-154655361 GGGGAGATGGAAATAAATGCTGG - Intergenic
964766167 3:160179843-160179865 GGGGAGAGAGAGACAAAAGGGGG + Intergenic
965821839 3:172692010-172692032 GGTGAGAGGGAAACCAGACTGGG + Intronic
966398843 3:179527162-179527184 AGGGGGAGGGAAAGAAAAGCAGG + Intergenic
966557390 3:181277948-181277970 GAAGAGAGGGAAACAAAATGAGG + Intergenic
966865205 3:184255043-184255065 GGTGAAGGGGAAACAAAAGCTGG - Intronic
966880563 3:184347648-184347670 GGGGAGAGAGACTCCAAACCTGG - Intronic
967182056 3:186913904-186913926 GGAGAGAAGGAAAGAACACCTGG - Intergenic
967770793 3:193331456-193331478 AAGTAGAGGGAAACAGAACCAGG - Intronic
968267218 3:197371414-197371436 GGGGTGATAGAAACAGAACCAGG - Intergenic
968454200 4:688916-688938 GGCCACAGGAAAACAAAACCCGG + Intronic
969173712 4:5383900-5383922 GGGGAGAGAGACACAACACGTGG + Intronic
969178523 4:5419283-5419305 TGGGAGAGGAGAACAAAGCCAGG - Intronic
970816866 4:20167063-20167085 GGGGAAGGGGAAGCAAATCCAGG + Intergenic
970872779 4:20835194-20835216 AGAGAGATGGAAAGAAAACCAGG - Intronic
972086471 4:35223365-35223387 AGGGAGAGGGATATAAAACCAGG - Intergenic
972355650 4:38277673-38277695 AGGGAGAGGGTTTCAAAACCAGG - Intergenic
972553217 4:40152823-40152845 GGGGAGAGGAAACCACAGCCAGG + Exonic
974263130 4:59550678-59550700 GAGGAGTGGGAAACAAAAGGTGG + Intergenic
974348518 4:60714524-60714546 GGGGAGAGGGAAACTGAAGAGGG - Intergenic
974847172 4:67364812-67364834 TGGGAGAGGGAAAAAAAATGTGG + Intergenic
975715587 4:77202725-77202747 GGGGTGAGTGAGACAAAACTGGG - Intronic
975760298 4:77613501-77613523 GTGGAAAGCGAAACAAAAGCAGG + Intergenic
975929877 4:79507060-79507082 GGGGAGAGGGAAAAAGAATGGGG - Intergenic
976156512 4:82150622-82150644 GCAGAGAGGGAAAGAAATCCAGG + Intergenic
976547896 4:86358993-86359015 GGGGAGAGGAACACAGAACAGGG - Intronic
977390276 4:96400426-96400448 TGGGAGAGGGTATTAAAACCAGG + Intergenic
978374319 4:108059183-108059205 GGGGAGACAGGAACACAACCGGG + Intronic
978604755 4:110467241-110467263 AGGGAGAGGAAAAGAAACCCAGG + Intronic
979261743 4:118655661-118655683 GAGCAGGAGGAAACAAAACCAGG - Intergenic
980280944 4:130718773-130718795 GTGGAGATGGAAAGAACACCAGG - Intergenic
980714768 4:136615064-136615086 GAGGAGAAGGAAAAAAAAACTGG - Intergenic
981001756 4:139835046-139835068 AGGGAGAGGGGAACAAGACAAGG + Intronic
981010708 4:139922069-139922091 GGGCAGAGGGAAATCAATCCAGG + Intronic
982468887 4:155762164-155762186 GGGGAGAGGGGAGGAGAACCTGG + Intronic
982612357 4:157591755-157591777 GGGGAGGGGGAAAGAAAAGAGGG - Intergenic
984193642 4:176633455-176633477 GGGGAGAGGGGAAACCAACCAGG + Intergenic
984846196 4:184110049-184110071 GGGGAGATGGAAGCAGAGCCAGG + Intronic
985426388 4:189835307-189835329 GGGGAAAAGGAACCAAATCCGGG + Intergenic
985430162 4:189871530-189871552 GAGTAGAGGGAAAAAAAACAAGG - Intergenic
985694339 5:1331419-1331441 GGGGCGAGGGAACCAAGACAGGG + Intronic
985716780 5:1467414-1467436 GGGGAGCGGGAACCAGGACCCGG + Intronic
986677807 5:10202246-10202268 TGGGAGAAGGAAACAAAAGCGGG + Intergenic
988665811 5:33326255-33326277 TGAGGGAGGGAAACAAAACAGGG - Intergenic
988853965 5:35208427-35208449 GGGGATAGACAAACAAAACCAGG - Intronic
990468512 5:56091530-56091552 GAGGAGAGAGAAACAAAATCAGG - Intergenic
990941879 5:61210743-61210765 TGGGAGAGGGAAGCAAAATCAGG - Intergenic
991255941 5:64614880-64614902 GGTAAGAGAGAAACAAAACCTGG + Intergenic
991520798 5:67494768-67494790 GGGGAAAGGGGAAGAAAGCCAGG - Intergenic
991564417 5:67989912-67989934 GGGGAGAGAGAAAGAAAGGCTGG + Intergenic
992069382 5:73135596-73135618 AGGGCGTGGGAAACAAAGCCAGG + Intergenic
993789382 5:92188781-92188803 GGGGAGAGGGGAACCCTACCAGG + Intergenic
993971268 5:94422642-94422664 AGGCAGAGGGAAAGAAAAACGGG - Intronic
994683718 5:102923139-102923161 GGGGTGAGGGACCCAGAACCAGG - Intronic
995127010 5:108588221-108588243 AGGGAGCTGGACACAAAACCAGG + Intergenic
996077414 5:119213187-119213209 GGGGAGTAGGAAACAAATACTGG - Intronic
997084456 5:130781603-130781625 GGGGAGAGAGGAAGAAAATCAGG + Intergenic
997281639 5:132651979-132652001 GTGGAGAGGGAAAAAAAAGAGGG - Intergenic
997831829 5:137157053-137157075 GGGGAGAAGGAAATAATAACAGG - Intronic
998405957 5:141874840-141874862 GGGGAGAGGGGAAGAAAATGGGG + Intronic
998509012 5:142695979-142696001 GAGGAGAGGGAGACAGAACTGGG + Intronic
998760579 5:145427835-145427857 GAGAAGAGGGACAGAAAACCAGG + Intergenic
999696694 5:154193325-154193347 TGGGAGAGTGAAACAAAAAGGGG - Intronic
1001033771 5:168282055-168282077 AGAGAGAGAGAAAAAAAACCAGG + Intergenic
1001041255 5:168337183-168337205 GGGGAGAGAGTTACAAAACCAGG - Intronic
1002113006 5:176933132-176933154 CGGGTGAGTGAAACAAACCCTGG + Intronic
1002319022 5:178364189-178364211 GGAGGGAGGGAAACAAAGCCAGG - Intronic
1002433383 5:179217109-179217131 GGGGAGCTGGAAACAACACGGGG + Intronic
1002506298 5:179681439-179681461 GGGGTGAGGGAAGCAAGACAGGG + Intronic
1002732308 5:181348780-181348802 GAGCAGGAGGAAACAAAACCAGG - Intergenic
1002752231 6:125324-125346 GAGCAGGAGGAAACAAAACCAGG + Intergenic
1003081489 6:3025024-3025046 GGGGAGAGGGAAATAAGCACAGG + Intergenic
1003329876 6:5121091-5121113 GGGTGGAGGGAAGGAAAACCAGG - Intronic
1003435247 6:6082041-6082063 GGAGAGAGGGCCATAAAACCCGG + Intergenic
1003441927 6:6150880-6150902 GAGGAGAGGGAAATAAAGTCAGG + Intronic
1003676084 6:8205755-8205777 GGGGGGAGGGAAAGAAAAGGGGG + Intergenic
1003692106 6:8365030-8365052 GGGGAGGCAGAAACAAGACCAGG - Intergenic
1004450926 6:15745553-15745575 TGTGAGAGGTAAACAAAACCTGG - Intergenic
1005332138 6:24760892-24760914 GGAGAGAGGGAGAAAGAACCAGG - Intergenic
1005478490 6:26232839-26232861 GGGGAGGTGGAAAAAAAAACAGG + Intergenic
1006028825 6:31164538-31164560 GGAGCTAGGGAAAGAAAACCTGG - Exonic
1006334909 6:33415399-33415421 GGGGAGAGGGAAAAGAATTCTGG - Intronic
1006591115 6:35158446-35158468 TGGTAGAGGGAGAGAAAACCAGG - Intergenic
1007017310 6:38481660-38481682 GATGAGAGAGAAAGAAAACCTGG + Intronic
1007177893 6:39909146-39909168 GGGGAGAGGGAGAGGAAAGCAGG + Intronic
1007177903 6:39909173-39909195 GGGGAGAGGGAGAGGAAAGCAGG + Intronic
1007177912 6:39909200-39909222 GGGGAGAGGGAGAGGAAAGCAGG + Intronic
1007177925 6:39909232-39909254 GGGGAGAGGGAGAGGAAAGCAGG + Intronic
1007177939 6:39909265-39909287 GGGGAGAGGGAGAGGAAAGCAGG + Intronic
1007177953 6:39909298-39909320 GGGGAGAGGGAGAGGAAAGCAGG + Intronic
1007177962 6:39909325-39909347 GGGGAGAGGGAGAGGAAAGCAGG + Intronic
1007325710 6:41058031-41058053 GGGGAGAGGGAATAGAAATCAGG + Intronic
1007470569 6:42087652-42087674 GGGGAGTGAAAAAGAAAACCAGG - Intergenic
1007742858 6:44023321-44023343 GGTCAGAGGGAAACAAATGCAGG + Intergenic
1008122443 6:47633865-47633887 GTGGAGAGGGAGACAGAATCAGG - Intergenic
1009632151 6:66213651-66213673 GTGGGGTGGGAAACAAAAACTGG + Intergenic
1009758258 6:67969246-67969268 TGGGAAAGGGAAACAAGACAAGG + Intergenic
1012243518 6:96900599-96900621 GGGCAGAGGGAAACAAAGTGGGG - Intergenic
1012754261 6:103204823-103204845 GGGGAAAGGGAAAAAAAAACAGG + Intergenic
1014148736 6:118028684-118028706 GGGCATAGGGAAAGAAAATCAGG + Intronic
1014622279 6:123683002-123683024 GGTGAGATGGAAACAGAAACTGG + Intergenic
1015101056 6:129481290-129481312 GGGGAGAGCTCCACAAAACCAGG - Exonic
1015293189 6:131561282-131561304 AGGGAGAGGGAAACTGTACCAGG - Intergenic
1015344923 6:132145065-132145087 GGGGAGAGAGAAAAGAAACTTGG - Intergenic
1016830122 6:148425741-148425763 GGGGACAGGGAAAAAAAAAAAGG - Intronic
1017075259 6:150612034-150612056 GGGGGGGGGGGAACAACACCAGG - Intronic
1017199246 6:151734530-151734552 GGGGAGAGGGACTCACCACCTGG + Intronic
1018055542 6:160049193-160049215 GTGCAGAGGTAAACACAACCAGG - Intronic
1018198651 6:161376378-161376400 GAGGAGACAGAAACAAAAGCAGG - Intronic
1018491449 6:164298008-164298030 GGTAAGAAGGAAACAAAGCCAGG - Intergenic
1019161884 6:170074480-170074502 AGGAACAGAGAAACAAAACCTGG + Intergenic
1019236559 6:170621096-170621118 GAGCAGGAGGAAACAAAACCAGG - Intergenic
1020310031 7:6860186-6860208 GAGGAGGAGGAAACAAAACAAGG + Intergenic
1020505314 7:8979536-8979558 AGGGAGGTGGAAACAAAACCAGG + Intergenic
1022425803 7:30267545-30267567 GGGGAGAAGGAGACTGAACCAGG + Intergenic
1022811638 7:33874388-33874410 GGAGAGAGGGAGACAAAATCAGG - Intergenic
1023104579 7:36750866-36750888 GGAGAGATGGAAACAAACCAAGG + Intergenic
1023765615 7:43507920-43507942 GGGGAGTGAGAACCTAAACCTGG + Intronic
1024256527 7:47543934-47543956 GAGCAGAGGGAAACAAATGCTGG - Intronic
1024511330 7:50207167-50207189 TGGGACAGAGAAACAAAAGCAGG - Intergenic
1024997280 7:55281635-55281657 AGAGAGAGAAAAACAAAACCTGG + Intergenic
1025032454 7:55569065-55569087 GGGGAGAGGGAGATAAAATCAGG + Intronic
1026931731 7:74226715-74226737 TGGCAGAGAGAAACAAAACAGGG + Intronic
1028988508 7:97025903-97025925 GGGGAGAGGGTACAGAAACCCGG - Intergenic
1030179827 7:106694741-106694763 GGAGAGAGAGAAAGAGAACCTGG - Intergenic
1031079385 7:117243386-117243408 GGGGAGAGGGAGAAAACAGCCGG - Intergenic
1033159645 7:138984042-138984064 GGGGAGGGGGAAAATTAACCTGG + Intergenic
1033160283 7:138990168-138990190 GAGGAGAGGCAAACAAAAAGGGG + Intergenic
1035511212 8:185512-185534 GAGCAGGAGGAAACAAAACCAGG + Intergenic
1035937495 8:3857782-3857804 GGGGAAAAGGATACAACACCAGG + Intronic
1036587812 8:10141223-10141245 GGGGCGAGGCACACAGAACCAGG - Intronic
1036637812 8:10563938-10563960 GGGAAGAGGGAAGCCAAGCCAGG + Intergenic
1036973089 8:13376951-13376973 GAGGAGAAGGAAAAAAAATCTGG + Intronic
1037046206 8:14307462-14307484 TGGGAGAGGGAGAGAAAAACTGG - Intronic
1037593579 8:20334702-20334724 TGGGAGAGGGAGAGAAAGCCGGG + Intergenic
1037601988 8:20404703-20404725 GGGAAGAAGGAAACAATTCCCGG - Intergenic
1037693804 8:21206628-21206650 GGGGCGAGGGAGATAAAACCAGG - Intergenic
1037918988 8:22790596-22790618 GTGGAGGGGGAAATAAAAGCTGG + Intronic
1038472706 8:27838687-27838709 GCGGAGAGGTAAAAAAAAACTGG - Intergenic
1038613004 8:29071340-29071362 GGGGAGACCGGAACAAAAGCGGG + Intronic
1039100629 8:33938232-33938254 GTGGAGAAGTACACAAAACCAGG - Intergenic
1039394232 8:37209613-37209635 GGAAAGAGGGAGACAAAAGCAGG - Intergenic
1039486987 8:37917883-37917905 GGAGAGAAAGAAACAAAATCAGG - Intergenic
1039888401 8:41668598-41668620 GGGGAGAGAGAAAAGACACCTGG + Intronic
1040111896 8:43570381-43570403 GGGGGGAGAGACACAAATCCTGG + Intergenic
1040557271 8:48491814-48491836 GGAGAGAGGGAAATAAAATCTGG - Intergenic
1041231352 8:55756517-55756539 GGGGAAAGGGGAAGAGAACCAGG - Intronic
1041618317 8:59934371-59934393 GGGAAGAGGGAAACACACACAGG + Intergenic
1042150593 8:65778938-65778960 AGGGATAGAGAAACAAAAACAGG - Intronic
1042448412 8:68916690-68916712 GGGGAAAGAGAAAGAACACCAGG - Intergenic
1044474619 8:92611804-92611826 GGGGAAAAGCAAACAAAAACAGG + Intergenic
1045026431 8:98091437-98091459 TGGGAGAGGCAAATAAAAGCAGG + Intronic
1045106892 8:98901462-98901484 GGGGAGAGAAAAAGAAAGCCTGG + Intronic
1045420444 8:102009418-102009440 AGGGAGACGGAAACAAAAACAGG - Intronic
1045900529 8:107274033-107274055 TAGGAGAAGGAAACAAAACATGG - Intronic
1046963004 8:120129408-120129430 GAAGAGAGGGAAAAAAAGCCAGG + Intronic
1048317786 8:133375011-133375033 AGGGAGAAGGAAACTAAGCCGGG + Intergenic
1048459706 8:134611437-134611459 AGGGAGACAGAAATAAAACCAGG + Intronic
1048701301 8:137092889-137092911 GGGAAGAGGGAAAGAAGAACAGG - Intergenic
1049213986 8:141399354-141399376 GGCCAGAGGGAAGCAAAGCCCGG - Intronic
1049340366 8:142109222-142109244 GGGGAGAGGGAAATGGCACCAGG - Intergenic
1049387911 8:142353621-142353643 TGGGGGTGGGAAACAAATCCAGG + Intronic
1049944235 9:579209-579231 GGGCAGAGGGAAGCAGACCCAGG - Intronic
1052785395 9:32823440-32823462 GGGGAGGGGGAAACATCACCGGG - Intergenic
1052995897 9:34551581-34551603 GGGGAGGGGTATACAAAACAGGG + Exonic
1053465706 9:38306867-38306889 GGGGAGAGAGGAACAGAGCCCGG - Intergenic
1055550168 9:77425877-77425899 GGGGAGGGGCAAACAGAAGCAGG - Intronic
1055734772 9:79314916-79314938 GAGTGGAGGGAAAAAAAACCTGG + Intergenic
1058218135 9:102260559-102260581 CGGGAGAGAAAAACAATACCTGG - Intergenic
1058409287 9:104713074-104713096 GGGGAGAGAAGAATAAAACCTGG + Intergenic
1058666211 9:107318357-107318379 GAGGAGGAGGAGACAAAACCAGG - Intronic
1060848016 9:126852609-126852631 GGGCAGGGGGAAACAAAGCCAGG + Intergenic
1062227289 9:135460030-135460052 GGAGAGAGGGAAAGACACCCAGG - Intergenic
1062229849 9:135475878-135475900 GGGGAGAGTGAAATGAACCCTGG - Intergenic
1062630844 9:137462446-137462468 GGGGAGAGGGTAGCAGCACCCGG + Intronic
1062756709 9:138301107-138301129 GAGCAGGAGGAAACAAAACCAGG - Intergenic
1186117055 X:6315453-6315475 GGGGAAAGAGAAATAAAATCCGG + Intergenic
1186206152 X:7203015-7203037 GGAGAGACAGAGACAAAACCAGG - Intergenic
1186643154 X:11478873-11478895 GGGCACAAAGAAACAAAACCAGG + Intronic
1187930239 X:24286870-24286892 GGGGAGAGGGTAACAGAAGAGGG + Intergenic
1187954491 X:24503301-24503323 TGTGAGAGGGAAACAAAACGTGG - Intronic
1187985758 X:24808698-24808720 GGGGAGAGGGCAATAAAAAATGG + Intronic
1189286111 X:39853621-39853643 GGGGAGAGGGATGGAAAAGCAGG + Intergenic
1189555054 X:42134712-42134734 GGGGAGTGGTAGATAAAACCAGG - Intergenic
1189622450 X:42856614-42856636 GTGAAAAAGGAAACAAAACCAGG - Intergenic
1189627830 X:42918483-42918505 GGGAAGAGATAGACAAAACCAGG + Intergenic
1190136893 X:47806204-47806226 GGGGAGCTGGAAACAGGACCTGG - Intergenic
1190983600 X:55480576-55480598 GTGTAGAGGAGAACAAAACCAGG + Intergenic
1192201333 X:69068551-69068573 TGGGAGAGGGAGACAAAGGCAGG - Intergenic
1193191335 X:78574268-78574290 GGAGAGAGAGAAAAAAAACCTGG + Intergenic
1193199454 X:78671144-78671166 GGGTAGAGGGAAAGAAAGGCGGG + Intergenic
1194413406 X:93581225-93581247 GGGGAGAAGAAAACAACACACGG + Intergenic
1195329503 X:103785795-103785817 GGAGAGAGGGAAAAAAAAGATGG - Intronic
1198159150 X:133989763-133989785 GGGGAGAGGAGAACATCACCTGG - Intergenic
1198530904 X:137549172-137549194 GTGGAACGGGAAACAAAAGCAGG + Intergenic
1200090862 X:153635363-153635385 AGAGTGAGGGAAAGAAAACCAGG + Intergenic
1200627094 Y:5532796-5532818 GGGGAGAGAGAAACAGAAAAGGG - Intronic
1201283585 Y:12360939-12360961 GGGGAGAGAGAAAAAAAAAGAGG + Intergenic
1201518759 Y:14848946-14848968 GGTGAGATGCAAGCAAAACCAGG - Intergenic
1201528232 Y:14960530-14960552 GGGGAGAGGAACAGAAAACCAGG - Intergenic
1201687542 Y:16723815-16723837 GGTGAGAGGGAGACATAACAAGG + Intergenic
1202092825 Y:21211921-21211943 TTGGAGAGGGAAACAACACGTGG + Intergenic
1202383830 Y:24304124-24304146 GAGCAGGAGGAAACAAAACCAGG - Intergenic
1202486953 Y:25365996-25366018 GAGCAGGAGGAAACAAAACCAGG + Intergenic