ID: 1134537821

View in Genome Browser
Species Human (GRCh38)
Location 16:15040780-15040802
Sequence CAGGCACTTTCCCAGCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134537814_1134537821 14 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537821 16:15040780-15040802 CAGGCACTTTCCCAGCTCCTGGG No data
1134537816_1134537821 9 Left 1134537816 16:15040748-15040770 CCTGGGGTGCTGGGGGGAGAGGG No data
Right 1134537821 16:15040780-15040802 CAGGCACTTTCCCAGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134537821 Original CRISPR CAGGCACTTTCCCAGCTCCT GGG Intronic
No off target data available for this crispr