ID: 1134537822

View in Genome Browser
Species Human (GRCh38)
Location 16:15040784-15040806
Sequence CACTTTCCCAGCTCCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134537814_1134537822 18 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537822 16:15040784-15040806 CACTTTCCCAGCTCCTGGGAAGG No data
1134537816_1134537822 13 Left 1134537816 16:15040748-15040770 CCTGGGGTGCTGGGGGGAGAGGG No data
Right 1134537822 16:15040784-15040806 CACTTTCCCAGCTCCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134537822 Original CRISPR CACTTTCCCAGCTCCTGGGA AGG Intronic
No off target data available for this crispr