ID: 1134537828

View in Genome Browser
Species Human (GRCh38)
Location 16:15040794-15040816
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134537819_1134537828 -8 Left 1134537819 16:15040779-15040801 CCAGGCACTTTCCCAGCTCCTGG No data
Right 1134537828 16:15040794-15040816 GCTCCTGGGAAGGGTGGGCATGG No data
1134537814_1134537828 28 Left 1134537814 16:15040743-15040765 CCGGGCCTGGGGTGCTGGGGGGA No data
Right 1134537828 16:15040794-15040816 GCTCCTGGGAAGGGTGGGCATGG No data
1134537816_1134537828 23 Left 1134537816 16:15040748-15040770 CCTGGGGTGCTGGGGGGAGAGGG No data
Right 1134537828 16:15040794-15040816 GCTCCTGGGAAGGGTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr