ID: 1134537908

View in Genome Browser
Species Human (GRCh38)
Location 16:15041399-15041421
Sequence CCCTCGTCTACCAGGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134537908_1134537916 -4 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537916 16:15041418-15041440 AGGGGGCTGCACTGGAACTGAGG 0: 1
1: 0
2: 0
3: 21
4: 268
1134537908_1134537924 25 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537924 16:15041447-15041469 AGATGGTGGACGAGGGCAAGGGG 0: 1
1: 0
2: 1
3: 22
4: 268
1134537908_1134537920 17 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537920 16:15041439-15041461 GGCTCGGCAGATGGTGGACGAGG 0: 1
1: 0
2: 0
3: 28
4: 158
1134537908_1134537917 1 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537917 16:15041423-15041445 GCTGCACTGGAACTGAGGCTCGG 0: 1
1: 0
2: 1
3: 18
4: 260
1134537908_1134537918 8 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537918 16:15041430-15041452 TGGAACTGAGGCTCGGCAGATGG 0: 1
1: 0
2: 0
3: 18
4: 198
1134537908_1134537925 29 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537925 16:15041451-15041473 GGTGGACGAGGGCAAGGGGAAGG 0: 1
1: 0
2: 8
3: 175
4: 1494
1134537908_1134537922 23 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537922 16:15041445-15041467 GCAGATGGTGGACGAGGGCAAGG 0: 1
1: 0
2: 3
3: 26
4: 330
1134537908_1134537926 30 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537926 16:15041452-15041474 GTGGACGAGGGCAAGGGGAAGGG 0: 1
1: 0
2: 7
3: 51
4: 588
1134537908_1134537923 24 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537923 16:15041446-15041468 CAGATGGTGGACGAGGGCAAGGG 0: 1
1: 0
2: 3
3: 25
4: 205
1134537908_1134537921 18 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537921 16:15041440-15041462 GCTCGGCAGATGGTGGACGAGGG 0: 1
1: 0
2: 2
3: 6
4: 89
1134537908_1134537919 11 Left 1134537908 16:15041399-15041421 CCCTCCTTCCTGGTAGACGAGGG No data
Right 1134537919 16:15041433-15041455 AACTGAGGCTCGGCAGATGGTGG 0: 1
1: 0
2: 1
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134537908 Original CRISPR CCCTCGTCTACCAGGAAGGA GGG (reversed) Intronic
No off target data available for this crispr