ID: 1134539935

View in Genome Browser
Species Human (GRCh38)
Location 16:15056037-15056059
Sequence GCCCGAGGGGCGGGGGCGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1142
Summary {0: 1, 1: 0, 2: 14, 3: 139, 4: 988}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134539935_1134539950 15 Left 1134539935 16:15056037-15056059 CCCGCCGCCCCCGCCCCTCGGGC 0: 1
1: 0
2: 14
3: 139
4: 988
Right 1134539950 16:15056075-15056097 GTCCTGCCCCGCCCCACCGCGGG 0: 1
1: 0
2: 7
3: 47
4: 367
1134539935_1134539955 24 Left 1134539935 16:15056037-15056059 CCCGCCGCCCCCGCCCCTCGGGC 0: 1
1: 0
2: 14
3: 139
4: 988
Right 1134539955 16:15056084-15056106 CGCCCCACCGCGGGCGCTGCCGG 0: 1
1: 1
2: 0
3: 14
4: 159
1134539935_1134539956 25 Left 1134539935 16:15056037-15056059 CCCGCCGCCCCCGCCCCTCGGGC 0: 1
1: 0
2: 14
3: 139
4: 988
Right 1134539956 16:15056085-15056107 GCCCCACCGCGGGCGCTGCCGGG 0: 1
1: 0
2: 1
3: 22
4: 232
1134539935_1134539949 14 Left 1134539935 16:15056037-15056059 CCCGCCGCCCCCGCCCCTCGGGC 0: 1
1: 0
2: 14
3: 139
4: 988
Right 1134539949 16:15056074-15056096 CGTCCTGCCCCGCCCCACCGCGG 0: 1
1: 0
2: 3
3: 37
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134539935 Original CRISPR GCCCGAGGGGCGGGGGCGGC GGG (reversed) Exonic
900001575 1:17566-17588 GGCCGAGGGGTGTGGGCGGGAGG - Intergenic
900021294 1:188090-188112 GGCCGAGGGGTGTGGGCGGGAGG - Intergenic
900087392 1:904975-904997 GCCGGAGGGTCGGGGGTGCCGGG + Intergenic
900096401 1:941841-941863 ACCCGAGCGGCGGGGGAAGCGGG - Intronic
900168470 1:1254515-1254537 GCGAGCGGGGCGGGGGCTGCCGG - Intronic
900190027 1:1349349-1349371 GCCCGAGGGGCGCAGGCGGGAGG - Intronic
900243274 1:1626764-1626786 GCGCTAGCGGCGGGGGTGGCAGG - Intronic
900314561 1:2050458-2050480 GCGCGCGGGGCGGGAGCGGGGGG - Exonic
900314905 1:2051647-2051669 GCCCCAGAGGCAGGGACGGCCGG + Intronic
900342240 1:2194678-2194700 GCCCGGCGGGCGGGTGAGGCCGG - Exonic
900390060 1:2429860-2429882 GCAGGAGGGGCTGGGGGGGCCGG + Intronic
900413898 1:2526383-2526405 GGCCGGCGAGCGGGGGCGGCGGG - Intronic
900428727 1:2592277-2592299 GCCTCAGGGGAGGGGGCGTCAGG - Intronic
900607874 1:3531806-3531828 GGCCGCGGGGCGGGGGAGGGGGG + Intronic
900607887 1:3531827-3531849 GGCCGCGGGGCGGGGGAGGGGGG + Intronic
900650577 1:3728146-3728168 GCACCAAGGGCGGGGACGGCAGG - Exonic
900786728 1:4654515-4654537 GTTCGAGGGGCGGGGAAGGCGGG + Intergenic
900786770 1:4654657-4654679 GCGCGGTGGGCGCGGGCGGCGGG + Intergenic
901016732 1:6236108-6236130 CCCCGAGGGGCGGGGAGGGGCGG - Intergenic
901151685 1:7107613-7107635 CCCGGAGGGGCGGGTGCTGCTGG + Intronic
901238557 1:7680241-7680263 GACCGAGGGGAGGGGCCGGGAGG - Intronic
901242981 1:7705379-7705401 GTGCGAGGGGCGTGTGCGGCGGG + Intronic
901650700 1:10741372-10741394 GTCCTGGGGGTGGGGGCGGCAGG + Intronic
901659852 1:10792321-10792343 GCCGGGGGGGGGGGGGCGGGGGG - Intronic
901679617 1:10905351-10905373 CCTCAAGGGGTGGGGGCGGCGGG + Intergenic
901786162 1:11626220-11626242 GCCCAAGGGGTGGGGTGGGCGGG + Intergenic
901794623 1:11673209-11673231 GCCCCAGGGGTGGGGGCAGGTGG - Intronic
901796066 1:11680519-11680541 GGCCCGGGGGCGGGGGCGTCTGG - Intronic
902415636 1:16237115-16237137 GCCCGGCGGGCTGGGGCGGCGGG - Exonic
902483425 1:16725036-16725058 GGCCGAGGGGCGCGAGCTGCGGG - Intergenic
902585659 1:17437774-17437796 CGCCGCGGGGAGGGGGCGGCCGG - Intronic
902810649 1:18886068-18886090 GCAGGAGGGGCTGGGGTGGCTGG - Intronic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903034483 1:20485451-20485473 GCGCTGGGGCCGGGGGCGGCCGG + Exonic
903044290 1:20553888-20553910 GCGCGGGCGGCGGGGGCGCCGGG - Exonic
903078110 1:20787345-20787367 GCGCGGGAGGCGGGGCCGGCGGG - Intergenic
903132768 1:21290327-21290349 GCCTGGAGGGCGGGGGCGGGAGG - Intronic
903233797 1:21937113-21937135 GGGCGGGGGGCGGGGGCGGAGGG - Intronic
903408276 1:23117503-23117525 GCCCTGGGGGGGGGGGCGGGGGG + Intronic
903413960 1:23168737-23168759 GTCCGTGAGGCGGCGGCGGCGGG - Intronic
903446077 1:23423919-23423941 GCCCGCGGGGCGGGGGAAGGGGG - Intronic
903569469 1:24293782-24293804 GCCCCAGGGCCAGGGGTGGCAGG + Intergenic
903596901 1:24502372-24502394 GCCCGAGGAGAGGCGGCCGCAGG - Intronic
903750211 1:25616798-25616820 GCCCGAGCGGCGGCGGCGGCGGG + Intergenic
903925229 1:26826922-26826944 CGCGGCGGGGCGGGGGCGGCGGG - Exonic
904009843 1:27383242-27383264 GCTCGCGGGGTGGGGGTGGCCGG + Exonic
904696942 1:32336133-32336155 GCCCGAGGGGGAGGGGTGCCGGG + Exonic
904744768 1:32703653-32703675 GCCCCAGGGGCTGGGGTGCCTGG + Intergenic
904769044 1:32870839-32870861 GCCGGAGCGGCCGGGCCGGCCGG - Intronic
904772141 1:32886445-32886467 GCGCGCGCGGCAGGGGCGGCAGG - Exonic
905054238 1:35079360-35079382 GGGAGAGGGGCGGGGTCGGCGGG + Intronic
905066895 1:35192260-35192282 GCCCGCCGGGCGGGGGCCCCTGG + Exonic
905449183 1:38046272-38046294 GCCCGAGCGGCTGGGGCTGGTGG + Exonic
905960058 1:42035809-42035831 GCGCGCCGGGCCGGGGCGGCGGG + Intronic
906027026 1:42682608-42682630 GCGCTGAGGGCGGGGGCGGCGGG - Exonic
906097486 1:43234213-43234235 GGTGGAGGGGCGGGGGCTGCAGG - Intronic
906140365 1:43530845-43530867 GCGCGAGGGGAGCGCGCGGCTGG + Intronic
906214245 1:44030120-44030142 GCCCGAGGCGCGGAGGCCTCCGG + Intronic
906377809 1:45310186-45310208 TCCCGAGTGGCGGGGACTGCAGG - Intergenic
906520932 1:46466545-46466567 GCCGGCGGCGCGGGGGCGCCTGG - Intergenic
906615758 1:47231966-47231988 GCGGGAGGGGCGGCGGCAGCCGG + Intronic
906793432 1:48678228-48678250 GGCAGAAGGGCGGGGGCGGCGGG - Intronic
907278230 1:53328468-53328490 GCGCGTGGGGCGGGGGAGGGAGG + Intergenic
907372507 1:54012366-54012388 GCCTGAGGGGCTGGGGCAGTGGG + Intronic
907671399 1:56477694-56477716 GCCTGTGAGGTGGGGGCGGCCGG - Intergenic
908703936 1:66930435-66930457 GGCCCAGGGCCGGGGGCGCCCGG - Intronic
909657352 1:78046162-78046184 AGCCGACGGGCGCGGGCGGCGGG + Exonic
910180710 1:84479512-84479534 ACGCGAGAGGCGGGGGCTGCCGG + Intronic
910193865 1:84621095-84621117 GGCCGAGGGGCGGGGCACGCGGG + Intergenic
910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG + Intronic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
910773423 1:90851708-90851730 GGCCGAAGGGCGGGGCCGGGGGG - Intergenic
911144763 1:94541676-94541698 GCCCGTGGGGCTGGGGAGGTTGG + Exonic
912166143 1:107044862-107044884 GCCGGCAGGGCGGGGCCGGCAGG - Intergenic
914437229 1:147670662-147670684 GCCGGAGGGGCGAGGCCCGCAGG - Intergenic
914869132 1:151458834-151458856 CGCCGGGGGGCGGGGGCGGCCGG + Intronic
914902190 1:151716713-151716735 GCCCCAGCGGCGGGAGCAGCCGG - Exonic
915070489 1:153261671-153261693 TCTCCAGCGGCGGGGGCGGCGGG + Exonic
915143998 1:153783826-153783848 GCGAGAGGGGCGGGGCAGGCTGG + Intergenic
915340783 1:155175579-155175601 GCGGGAGAGGCGGGGGCTGCGGG - Exonic
915345565 1:155195257-155195279 GGCCGGGGGGCCGGGGGGGCCGG - Intergenic
915517534 1:156421872-156421894 GGGGGAGGGGCGGGGCCGGCGGG - Intronic
915519947 1:156436261-156436283 GCCCGAGGGCCGGGAGCTGCGGG + Intergenic
915541832 1:156572373-156572395 GCCTGAGGGGCGAGGGCGGTGGG - Intronic
916170458 1:161997992-161998014 GCCGGAGGAGCTGGGGCTGCTGG + Exonic
916792533 1:168136774-168136796 GGCCGAGGCGGGGAGGCGGCTGG - Intronic
916890252 1:169106605-169106627 GGCGGCGGGGCGGGGGCGGAGGG - Exonic
917262570 1:173186356-173186378 CCCTGAGGGGTGGGGGCGGGAGG + Exonic
917838468 1:178959027-178959049 GCGCGGGGGGCAGGGGTGGCGGG + Intergenic
918040874 1:180913116-180913138 CCCCGAGGGGCGAGGCCTGCGGG + Intergenic
918066400 1:181104991-181105013 GCCGGTGGGCTGGGGGCGGCAGG - Intergenic
918265672 1:182839548-182839570 GCGCGGGCGGCGGCGGCGGCTGG + Intronic
920190422 1:204190415-204190437 GCATGCGGGGCGGGGGCGGGGGG - Exonic
920312390 1:205056388-205056410 GCCTCAGAGGCGGAGGCGGCGGG - Intronic
920374645 1:205501305-205501327 GCCCCAGGGGCTGGGGTGCCAGG + Intergenic
920385746 1:205569313-205569335 GGCCGCGGGGCGGGGGCGCACGG - Intronic
920385792 1:205569413-205569435 GGCCGGGAGGCGGGGGCGACGGG - Intronic
920571773 1:207023091-207023113 GCCCGAGGGGCCAGGACAGCAGG - Exonic
921172044 1:212558802-212558824 GCCCGAGGGGTGGGGGCCCGCGG - Intergenic
921472674 1:215567569-215567591 GCCAGCGGGGCGGCGGCGGCCGG - Exonic
922467981 1:225857374-225857396 GCCGGCGGGGCGGGGGGGGGGGG + Intronic
922809202 1:228406592-228406614 GTCCGCGGGGCGGCGGCGGGCGG + Exonic
924289508 1:242523990-242524012 GCGCGCGGGGCGCGGGGGGCAGG - Intronic
924436875 1:244049446-244049468 GCCCGGGGGAGGGGGCCGGCGGG + Intronic
924560657 1:245154761-245154783 GCCGGCGCGGCGAGGGCGGCAGG + Intergenic
1062843903 10:690038-690060 GCCCGCGGGGCGGGGCGGGGCGG + Intergenic
1063455349 10:6178791-6178813 GGCCGAGGGGCAGGTGGGGCTGG - Intronic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065101539 10:22336319-22336341 GCCTGCGGGGCGGGGGTGGCGGG - Intergenic
1066180469 10:32957553-32957575 GCGCCGCGGGCGGGGGCGGCGGG - Intronic
1066429372 10:35336966-35336988 GGACGCGGGGCGCGGGCGGCGGG - Exonic
1066464217 10:35639480-35639502 GGCCGGGGGGCGGCGGCGGCGGG - Exonic
1066464514 10:35640824-35640846 GCGGCAGGGGCGGTGGCGGCGGG - Exonic
1067101849 10:43339710-43339732 GCCAGAGGGGCTGGTGGGGCAGG + Intergenic
1067300230 10:45001119-45001141 GGCCGCCGGGCGGGGGCGGGAGG + Intronic
1067449758 10:46375141-46375163 TCCCGAGGGGCTGTGGTGGCTGG + Intergenic
1067564303 10:47325790-47325812 GCCTGCGGGGCTGGGGAGGCAGG + Exonic
1067937730 10:50625018-50625040 GCCCGATGGGAGGGCGTGGCGGG - Intronic
1069024043 10:63521332-63521354 GGCCGGCGGGCGGGGGCGGGCGG + Intergenic
1069667134 10:70170354-70170376 GCTCGAGGGGCTGGGACGGAAGG - Intronic
1069780898 10:70954746-70954768 GCCCGTGGGCTGGGGGAGGCAGG - Intergenic
1069920583 10:71813182-71813204 GGGCGAGGGGCGGGGCAGGCAGG + Intronic
1070129743 10:73648026-73648048 GCCCGAGGAGCGTGGGGTGCTGG + Exonic
1070318997 10:75340154-75340176 GGCCGGGGGGAGGGGGCGGGGGG + Intergenic
1070800746 10:79243258-79243280 GCGCGGGGGGCGGGGGCGCACGG - Intronic
1071618146 10:87094892-87094914 GCCCGAGGGGAGGGGACAGCCGG - Intronic
1072465187 10:95656504-95656526 GCGCGAGGGGCGTGAGCGCCGGG - Intronic
1072591515 10:96832413-96832435 GCCGGAGGGGCGGCGGCGGTCGG - Intronic
1072700914 10:97640848-97640870 GTCCGAGTGGCGGCGGCGGCCGG + Exonic
1072784067 10:98268401-98268423 TCCCGGGGGGCGGGGGGAGCGGG + Intergenic
1072915950 10:99537397-99537419 GCTCTGGGGGAGGGGGCGGCAGG + Intergenic
1072952710 10:99861858-99861880 GCCCCAGGGGCCGAGGCTGCAGG - Intergenic
1073048340 10:100653125-100653147 GCCCGGGGGGCGGGGGTTGGGGG + Intergenic
1073052923 10:100680969-100680991 GCCCAAGCGCCGGGGGAGGCTGG - Intergenic
1073099433 10:100999223-100999245 GCCCGCGTGTTGGGGGCGGCTGG + Intronic
1073207463 10:101776370-101776392 GCGGGAGGGGCGGGGGCGGCCGG + Intronic
1073290072 10:102409132-102409154 GCCCGGGGGCCGAGGGCGGACGG - Intronic
1073331245 10:102671158-102671180 TCCCGAAGGGAGGGGGCTGCTGG + Intergenic
1073414325 10:103368461-103368483 CCCGGAGGGTCGGGGGCCGCAGG - Exonic
1073577776 10:104640345-104640367 GCAAGTGGGGCGGGGGCGGGAGG - Intergenic
1074121765 10:110498517-110498539 GCCGGAGGGGCGAGCGTGGCAGG - Intronic
1074169671 10:110919802-110919824 GCCCGAGGGGCCGGGGCCCTGGG + Intronic
1074618589 10:115093818-115093840 GGCCGGCGGGCGGCGGCGGCGGG + Exonic
1075974995 10:126687144-126687166 GCCAGAGGGGCTGGGGAGGCTGG - Intergenic
1076395909 10:130136960-130136982 GCCCGCCGGGAGGGAGCGGCAGG + Intronic
1076582477 10:131520882-131520904 GCCTGTGGGGCGGGGGCGAGGGG - Intergenic
1076707018 10:132307750-132307772 GCCGGCGGGGCGCGCGCGGCCGG + Exonic
1076710552 10:132331693-132331715 GCCGGAGGGCCCGGGGCGGGCGG - Intronic
1076858425 10:133128470-133128492 GCCCGAGGAGCAGCGGCGGCTGG + Exonic
1076986010 11:236432-236454 GCGCCGGGGGCGGGGGCGGTAGG - Intronic
1077008512 11:369969-369991 GCGCGGGGGGCGCGGGGGGCGGG + Intronic
1077008541 11:370032-370054 GCGCGGGCGGCGCGGGCGGCGGG + Intronic
1077043678 11:535320-535342 GCCGGGGGCGCGGGGCCGGCGGG - Intronic
1077063322 11:627038-627060 GCCCGGGGGGCGGGCGGGCCTGG + Intronic
1077064872 11:636696-636718 GGCTGCGGGGGGGGGGCGGCGGG + Intergenic
1077213319 11:1383366-1383388 GCGCCAGGAGCGGGGGTGGCGGG + Intergenic
1077216557 11:1397564-1397586 GCCCCAGGGGCCTGGGCTGCAGG + Intronic
1077228950 11:1450238-1450260 GCTCGGGGGGCGGTGGGGGCAGG - Intronic
1077311633 11:1891389-1891411 GCTGGAGGGGTGGGGGCGGAAGG + Intronic
1077360757 11:2139314-2139336 GGCCAGGAGGCGGGGGCGGCCGG + Intronic
1077491405 11:2862554-2862576 GCGCGAGGAGCGGGCGCGGCCGG - Intergenic
1077505776 11:2929477-2929499 GCCCGAGGGCCGGGGCGGGGCGG - Intergenic
1077524679 11:3057113-3057135 GTCCGAGGGGCGGGGGTGCTCGG - Intronic
1078190852 11:9091636-9091658 GCTCGGGGGGCGGGCGGGGCCGG - Intronic
1079071558 11:17352032-17352054 GACCGAAGGTAGGGGGCGGCTGG + Exonic
1079107057 11:17578487-17578509 GCCCGAGAGGCAGGGGCCACGGG - Exonic
1079122623 11:17696252-17696274 GCCCCAGGGGCAGTGGGGGCGGG + Intergenic
1079251901 11:18792741-18792763 TCCCGGGGGGCGGGGGTGGATGG - Intergenic
1079353531 11:19712935-19712957 GGCCGTGGGGCGCGGGCGCCGGG - Intronic
1080406872 11:31987505-31987527 GCGCGCGGGGCGCGGGCGGAGGG - Intronic
1080592570 11:33736468-33736490 TCCTGAGGGGCGGGGCCGGGGGG - Intergenic
1081720729 11:45286317-45286339 GCCAGAGGGGCGGGGACGGAGGG + Exonic
1081943763 11:46969238-46969260 GCAGGAGGGGCGGGGGCTTCAGG - Intronic
1082076577 11:47980350-47980372 GGCGGAGGGGCGGGCGAGGCGGG + Intergenic
1083267595 11:61553966-61553988 GGCGGAGGGGAGGGGGTGGCAGG + Intronic
1083429149 11:62604957-62604979 GCCCGGGTGGCAGGGGCTGCAGG + Intronic
1083546260 11:63551108-63551130 GCGGGAGGGGCGGGAGGGGCGGG + Intergenic
1083571791 11:63765145-63765167 CCCGGAGGGCCGGGGGCAGCAGG - Exonic
1083595631 11:63917266-63917288 GCCCGGGGGGCGGGGCCAGGGGG + Intergenic
1083613734 11:64016383-64016405 GGCAGAGGGGCGGGCGCAGCTGG - Intronic
1083648340 11:64185999-64186021 TCCTGAGGTGCGGGGGAGGCAGG + Intronic
1083672172 11:64305730-64305752 GCCCCAGGTCCGGGGGCGGAGGG + Intronic
1083713390 11:64562185-64562207 GCCATGGGGGCGGGGGTGGCAGG + Intronic
1083855385 11:65390625-65390647 GGCCGAGGAGCCGGGGCAGCAGG - Intronic
1083883040 11:65557895-65557917 ATGCGCGGGGCGGGGGCGGCGGG - Exonic
1084046028 11:66568243-66568265 GCGCCGGGGGCGGGGGCGCCAGG - Intronic
1084051167 11:66600874-66600896 GCCTGAGGGGCAGGGGCAGTGGG + Intronic
1084086391 11:66857167-66857189 GCCCGAGGGTGGGCGGCGGGCGG + Intronic
1084128703 11:67118231-67118253 GGCCCGGGGGCGGTGGCGGCCGG - Intergenic
1084168221 11:67387028-67387050 GCCAGAGGGTCGGGGGAGGCAGG + Intronic
1084333979 11:68446359-68446381 GCCCGAGGGGTGTGGGAGGAAGG + Intronic
1084336347 11:68460279-68460301 CCGGGCGGGGCGGGGGCGGCGGG - Intergenic
1084448534 11:69218433-69218455 GCCCAAGGGAGGTGGGCGGCTGG - Intergenic
1084547541 11:69821987-69822009 GTCAGAGGGGCTGGGGCAGCTGG - Intergenic
1084804834 11:71571598-71571620 GACGGAGGGGCGCAGGCGGCCGG + Intergenic
1084805621 11:71576925-71576947 GACGGAGGGGCGCAGGCGGCCGG - Intergenic
1085044015 11:73343109-73343131 GCCGCTGGGGCGGGGGCGCCGGG - Intronic
1085197941 11:74683556-74683578 GCCTGGGCCGCGGGGGCGGCGGG - Intergenic
1085409411 11:76282434-76282456 GGCAGAGGGACCGGGGCGGCAGG + Intergenic
1087761846 11:102110772-102110794 GCCCGTGGAGCCGGGGCGTCCGG + Exonic
1088406041 11:109480268-109480290 GAGCGGGGGGCGGGGGCGGGGGG - Intergenic
1089253068 11:117179056-117179078 CCCGCAGGGGAGGGGGCGGCCGG - Exonic
1089302029 11:117504608-117504630 GCCCCAGGGGAGGGTGCGGTAGG + Intronic
1089452950 11:118609922-118609944 GCCCGAGGAGAGGGGGAGCCGGG - Intronic
1089556240 11:119317215-119317237 GCGCGCGGGGCGGGGGCTGGGGG - Intronic
1089729457 11:120511520-120511542 GCGGGGGCGGCGGGGGCGGCGGG - Intergenic
1089729464 11:120511529-120511551 AGCCCAGGCGCGGGGGCGGCGGG - Intergenic
1090351827 11:126112854-126112876 CCCCGAGAGGCTGGGGCTGCGGG + Intergenic
1090385542 11:126355870-126355892 GCCCGCGGGGCGGGGCGGGGCGG + Intronic
1090635795 11:128689852-128689874 GCGGGAGGGCCGGGGGCGGGCGG - Intronic
1090699324 11:129279663-129279685 GCGCGAGGAGGGCGGGCGGCGGG + Intergenic
1091374661 12:17683-17705 GGCCGAGGGGTGTGGGCGGGAGG - Intergenic
1091450322 12:568878-568900 ACCCGGGGGGCGGGGGGGGGGGG - Intronic
1091474046 12:753977-753999 TCCCCAGGGGCGGCAGCGGCTGG - Exonic
1091550105 12:1530462-1530484 GCCCGAGGCGCGGGCTCGGGAGG - Intronic
1091648846 12:2294498-2294520 GAGTGAGGGGCGGGGGAGGCTGG + Intronic
1091915658 12:4270657-4270679 GCGCGGGGGTGGGGGGCGGCGGG - Intergenic
1092002729 12:5045018-5045040 GCCCCAGGGGCGGGCGCGGGAGG - Exonic
1092335427 12:7628752-7628774 GCGGCAGGGGCGGCGGCGGCAGG - Intergenic
1092502846 12:9065162-9065184 GGCTGATGGGCGGGGGCGGGGGG - Intergenic
1094470278 12:30796235-30796257 GGCCGCGGGGCGGCGGGGGCGGG - Intergenic
1095638373 12:44457646-44457668 GCCCCAGGGGTGGGGGTGGTGGG + Intergenic
1096191589 12:49623495-49623517 GCCGGGAGGGCGGGGCCGGCGGG - Exonic
1096227975 12:49881591-49881613 GCACGAGGGTCGGGCGGGGCTGG - Intronic
1096389404 12:51217485-51217507 AGCCGCGGGGCCGGGGCGGCGGG - Intronic
1096541441 12:52309587-52309609 GGCCCTGGGGTGGGGGCGGCGGG - Intergenic
1096732636 12:53626463-53626485 GGCCGAGAGGCGGGGGCTCCGGG + Intergenic
1096784414 12:54009056-54009078 GCGCGGGCGGCGGCGGCGGCGGG - Intronic
1096784493 12:54009246-54009268 GCCAGAGGGGAGGGGGCCGCGGG + Exonic
1096785794 12:54016616-54016638 GCCCGTGGGGAGTGGGCGGTGGG + Intronic
1096811565 12:54173663-54173685 GCGTGCGGGGCGGGGGCGGGCGG - Intronic
1096983631 12:55743161-55743183 CCCGGGGGGCCGGGGGCGGCGGG - Intergenic
1096983676 12:55743249-55743271 TCCCGCGGGGAGGGGGCGGAGGG - Intergenic
1097014319 12:55974377-55974399 GGCCGAGGGCCGGGGGCTGGAGG + Intronic
1097078531 12:56412685-56412707 GCCGGGCGGGGGGGGGCGGCAGG + Intergenic
1097172901 12:57127731-57127753 GCCCTAGGCGCGGGAGGGGCAGG - Intronic
1097185882 12:57196063-57196085 TGCGGAGGGGCGGAGGCGGCAGG - Intronic
1097190409 12:57216842-57216864 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1097190412 12:57216851-57216873 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1097222626 12:57460035-57460057 GCCCGGCGGGCTGGGCCGGCGGG + Intergenic
1097288728 12:57896708-57896730 CCCAGAGGGGCCCGGGCGGCGGG - Intergenic
1098161442 12:67649967-67649989 GCCCGGGCGGTGGGGGCGGGAGG + Intronic
1098312107 12:69158761-69158783 GGCGGCGGGGTGGGGGCGGCGGG - Intergenic
1098543521 12:71686100-71686122 GCGCTAGAGGCGGGGGCGCCGGG + Exonic
1098550378 12:71755151-71755173 GGCGGCGGGGCGGCGGCGGCGGG + Exonic
1099440056 12:82687676-82687698 GGCCGAGAGGAGGGGGCGACGGG + Intronic
1100611291 12:96194081-96194103 TCCCGAGGTGGGGAGGCGGCTGG - Intergenic
1100611396 12:96194346-96194368 GCGCACGGGGCCGGGGCGGCGGG + Intergenic
1100869405 12:98894892-98894914 GCGCGGGGGGCGGGGGCAGTGGG - Intronic
1101371714 12:104137574-104137596 GGGCGCGGGGCCGGGGCGGCCGG - Intronic
1102017431 12:109657042-109657064 GCACTGGGGGCTGGGGCGGCTGG - Intergenic
1102028034 12:109724526-109724548 GCCCGAGGAGGGTGGGCTGCTGG - Intronic
1102255700 12:111413628-111413650 GCCCAGGGGGCGGGGGAGGTTGG + Intronic
1102676755 12:114664723-114664745 GCCCTGGGGGCGGGGTGGGCGGG + Intergenic
1103381266 12:120496039-120496061 CGGCGAGGGGCGGGGCCGGCGGG + Intronic
1103488201 12:121296750-121296772 GCGCGGGGGGCGGGGGCGGGAGG + Intronic
1103527832 12:121579487-121579509 GGGCGGGCGGCGGGGGCGGCTGG - Intronic
1103595597 12:122022708-122022730 GCCCGGGAGGCGGGAGCGGGCGG - Intronic
1103649668 12:122422731-122422753 ACTCGAGGGGCCGGGCCGGCCGG - Intergenic
1103703420 12:122859370-122859392 GCCCGTGGGACGGGGGGGGACGG + Intronic
1103907857 12:124336460-124336482 ACCAGAGGGGCAGGCGCGGCCGG + Intronic
1104580494 12:130007867-130007889 GCCAGCGGGGCGGGAGCTGCAGG - Intergenic
1104975856 12:132551716-132551738 GGGCCAGGGGAGGGGGCGGCTGG - Intronic
1105407079 13:20142052-20142074 CTCCGAGGGGCAAGGGCGGCTGG + Exonic
1105943552 13:25171218-25171240 GCGACAGCGGCGGGGGCGGCGGG - Exonic
1105943643 13:25171587-25171609 GCCGGAGCCGCGGCGGCGGCGGG - Exonic
1106332863 13:28755176-28755198 GCCTGAGGAGAGGAGGCGGCAGG - Intergenic
1106735835 13:32586913-32586935 GCCGGGGCGGCGGCGGCGGCGGG + Intronic
1107145850 13:37059698-37059720 GGCCGAGGGGCGGGGAAGGCGGG + Intronic
1107468135 13:40667073-40667095 GGCCGAGGGCCGGGGGCGCGGGG + Intergenic
1107959007 13:45542677-45542699 GCCCGAGTGGCGGGACCAGCTGG - Intronic
1108322891 13:49304289-49304311 ACCCGAGGTGTGGGGGTGGCTGG - Intergenic
1108465554 13:50711762-50711784 GACCCAGTGGCGGGGGCGGGGGG + Intronic
1108498293 13:51045867-51045889 GCCTGAGGGGAGGGAGGGGCAGG - Intergenic
1110318445 13:74135067-74135089 GGCGGAGGGCCGGGCGCGGCAGG + Intergenic
1110318597 13:74135549-74135571 GCCGGAGGGTCGGCGGGGGCGGG + Intergenic
1110436185 13:75481052-75481074 GGGCGAGCGGCGGGAGCGGCCGG - Intronic
1112224573 13:97525913-97525935 TCCCGAGGGGCTGGGACTGCTGG + Intergenic
1112507731 13:99985198-99985220 TCCCCAGGGGCCAGGGCGGCGGG + Intronic
1113489511 13:110680142-110680164 GGCCGAGGGGGGGGGGGGGGGGG + Intronic
1113666329 13:112144058-112144080 GCATGGGGGGCAGGGGCGGCTGG - Intergenic
1113794767 13:113050710-113050732 GCAGGGGGGGCGGGGGCGGGGGG + Intronic
1113802992 13:113096129-113096151 GCGTGAGGGGCTGGGGCAGCTGG + Intronic
1113820655 13:113209871-113209893 GCCCCGGGAGCGGGGGCGCCGGG + Intronic
1113848402 13:113404835-113404857 GCCCGAGGGGCCGGGAAGCCCGG - Intergenic
1113947527 13:114052614-114052636 CCCCGAGGAGTGAGGGCGGCTGG - Intronic
1114312086 14:21476976-21476998 GCCGGAGGGGCGGGGGAGCGGGG - Intronic
1114620899 14:24095389-24095411 GCCCCAGGGGCAGGGGAGGAGGG - Intronic
1115771011 14:36663794-36663816 GCGCGAGAGGCGGGGGAGGGTGG - Intronic
1116817839 14:49599730-49599752 CGCCGAGTGGCGGGGGCAGCGGG + Intronic
1116817868 14:49599819-49599841 GCCGGAGGGGAGAGGGCCGCAGG - Intronic
1116821848 14:49634437-49634459 GCCCGGGGCCCGGGGGCTGCCGG + Exonic
1116849475 14:49893515-49893537 GCCCGGGTGGCGGCGGCGACTGG + Exonic
1117875929 14:60249723-60249745 GCCTGCGCGGCGGCGGCGGCGGG + Intronic
1118206490 14:63728077-63728099 GCGCGCGGGGCGGGGGCGCGCGG - Intergenic
1118220809 14:63853241-63853263 GAGCCGGGGGCGGGGGCGGCGGG + Intronic
1118463907 14:66013737-66013759 GCGCTGAGGGCGGGGGCGGCGGG + Intergenic
1118514306 14:66508858-66508880 GACCGAGGGGCCGGTGCGGAGGG + Intronic
1119487718 14:75002740-75002762 CCCCGAGGCGCGGGGGCGCGCGG + Intergenic
1120881439 14:89417458-89417480 CCCCGCGGGGCGGGGGTGACCGG + Intronic
1120993557 14:90398109-90398131 GGGCGGGGGGGGGGGGCGGCGGG + Intronic
1121093973 14:91202884-91202906 GCAGGAGGGTCTGGGGCGGCGGG - Intronic
1121417172 14:93787724-93787746 GCCCCAGGAGCGGGCGCCGCTGG - Exonic
1121453727 14:94025609-94025631 GCGCGGGGGGCGGGGGCGGGGGG + Intergenic
1121616957 14:95319816-95319838 GCCAGCGCGGCGCGGGCGGCGGG + Exonic
1121638226 14:95467928-95467950 GCCCGAGGGGCGTGTGAGGGTGG - Exonic
1122082035 14:99273235-99273257 GGCCGAGGAGCGCGGGGGGCGGG - Intergenic
1122108614 14:99480334-99480356 GCGCGAGGGCCGGGGACAGCGGG + Intronic
1122108878 14:99481192-99481214 CCCCGAGGGGCGGGACCGACGGG + Intronic
1122130857 14:99604040-99604062 GCGCGCGGGCGGGGGGCGGCCGG + Intergenic
1122329845 14:100904705-100904727 GGGCGGGGGGCGGGGGCTGCAGG + Intergenic
1122374063 14:101247085-101247107 GGATGAGGGGCAGGGGCGGCTGG - Intergenic
1122374502 14:101249024-101249046 GCCCGTGGGGAGGGCGTGGCAGG - Intergenic
1122666573 14:103334299-103334321 GCCCGAGGGGTCGAGGGGGCGGG - Intronic
1122666682 14:103334721-103334743 GCGCGCGGGGAGGGGGCGGCCGG - Intronic
1122750443 14:103928732-103928754 GCGGGCGGGGCGGAGGCGGCTGG + Intronic
1122817765 14:104321933-104321955 GCACTGGGGGCGGGGGCGGCTGG + Intergenic
1122910760 14:104826677-104826699 GCCGGAGGGGGCGGGGCTGCCGG + Intergenic
1122910769 14:104826695-104826717 GCCGGAGGGGGCGGGGCTGCCGG + Intergenic
1122940285 14:104978145-104978167 GCCCCAGGGGAGCGGGCTGCAGG + Intronic
1122993215 14:105248646-105248668 GTCGCAGGGGCGGGGGTGGCAGG + Exonic
1123033982 14:105464315-105464337 GCCTGGCGGGTGGGGGCGGCCGG + Intronic
1123487605 15:20755700-20755722 ACCCTAGGTGCGGGGGAGGCGGG - Intergenic
1123544097 15:21324758-21324780 ACCCTAGGTGCGGGGGAGGCGGG - Intergenic
1123675784 15:22709599-22709621 ACCCAAGAGGCGGAGGCGGCGGG - Intergenic
1124022726 15:25939034-25939056 GGTCGGGGGGGGGGGGCGGCGGG - Intergenic
1124121694 15:26893884-26893906 GCGCGCGGGGCGGCGGCAGCCGG + Intronic
1124327781 15:28782522-28782544 ACCCAAGAGGCGGAGGCGGCGGG - Intergenic
1125500842 15:40239567-40239589 GCCCGGGGGGCTGTGGCAGCAGG + Exonic
1125814858 15:42575610-42575632 GCGCGTGGGGCGGGCGGGGCTGG + Intergenic
1126407015 15:48331889-48331911 GCGCGGGGGGCGGGGGGGGTGGG + Intronic
1126502919 15:49366762-49366784 GCCTCCGTGGCGGGGGCGGCCGG + Intronic
1127342906 15:58065892-58065914 GGCCGGGGGGCGGGAGCGCCGGG - Exonic
1127849071 15:62897296-62897318 GCCGCAGGGGTGGGGGCCGCGGG + Intergenic
1127877264 15:63122076-63122098 GCCTCAGGGTCGGGGGCCGCGGG - Exonic
1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1128326872 15:66729589-66729611 GCCCCAGGCGAGGGGGCGCCGGG + Intronic
1128455079 15:67827565-67827587 GTGCGGGCGGCGGGGGCGGCGGG - Intronic
1128501460 15:68229846-68229868 CCTCGCGGGGCGGGGGCTGCTGG + Intronic
1129144186 15:73632911-73632933 ATCCGAGCGGCGGGGGCGTCCGG - Intronic
1129388062 15:75206801-75206823 GCCCCAGGGGCTGGGCCAGCTGG - Exonic
1130348466 15:83069263-83069285 GCAGGAGGGGAGGGGCCGGCGGG + Intergenic
1130613354 15:85380904-85380926 GGAGGAGGGGCGGGGGCTGCGGG + Intronic
1130770956 15:86923058-86923080 GCCCGAGGGATGGTGGTGGCAGG + Intronic
1131620968 15:94067661-94067683 GGGCGGGGGGCGGGGGCGGGGGG + Intergenic
1132451934 15:101973370-101973392 GGCCGAGGGGTGTGGGCGGGAGG + Intergenic
1202952439 15_KI270727v1_random:52031-52053 ACCCTAGGTGCGGGGGAGGCGGG - Intergenic
1132454961 16:17251-17273 GGCCGAGGGGTGTGGGCGGTAGG - Intronic
1132519791 16:381867-381889 GCCCGGGCGGCGGCGGGGGCCGG - Exonic
1132519835 16:381983-382005 GCCTGCGGGGCGGGGCCTGCGGG - Intronic
1132522238 16:397174-397196 GCGCGAGGAGCGGGCGCGGAGGG - Intronic
1132575238 16:660997-661019 GGCCGGGGGGGGGGGGGGGCGGG - Intronic
1132641830 16:981643-981665 GGTGGGGGGGCGGGGGCGGCCGG + Intergenic
1132729056 16:1351764-1351786 GCGCGCGGGCCGGGGGCGGAAGG - Exonic
1132834052 16:1943494-1943516 GCGCGAGGGGCGGCAGGGGCGGG - Intergenic
1132851595 16:2027243-2027265 GCGCTCGGGGAGGGGGCGGCGGG - Intronic
1132872891 16:2123559-2123581 GCCCGAGGGGCGGGGTGGGGGGG - Intronic
1132875614 16:2135661-2135683 GCCAGGCGGGCGGGCGCGGCGGG + Exonic
1132877942 16:2148602-2148624 GCCCGTGGAGCGGCGGGGGCGGG + Exonic
1132893235 16:2214787-2214809 GGCCGGCGGGCGGCGGCGGCCGG - Exonic
1132896813 16:2233175-2233197 GCCCCAGAGGTGGGGGCGACGGG + Exonic
1132915350 16:2340819-2340841 GCCGGAGCGGCCGAGGCGGCCGG - Intergenic
1132947278 16:2538373-2538395 GCGCGGAGGGCGGGGGAGGCCGG + Intronic
1132968438 16:2673083-2673105 GCGCGGAGGGCGGGGGAGGCCGG - Intergenic
1133026886 16:2992445-2992467 GCCGAAGGGGCTGGGGTGGCTGG + Intergenic
1133097683 16:3458315-3458337 GCCGGGGGCGCGGGCGCGGCCGG - Intronic
1133170601 16:3980554-3980576 GCCCGAAGGCTGGGGGCGGGGGG - Intronic
1133212653 16:4272061-4272083 CCCCGAGGGGCCCGCGCGGCCGG - Intronic
1133270542 16:4609083-4609105 GGCCCTGGGGAGGGGGCGGCGGG + Exonic
1133271941 16:4614598-4614620 GGCCGCCGGGCGGGGGCGGACGG - Intronic
1133292928 16:4734609-4734631 GCCCGAGGGGCGGACGCGAGCGG + Exonic
1133784300 16:8963179-8963201 GCCCGAGGGCCGGCCGCGGCGGG - Intronic
1134519372 16:14911692-14911714 GCCAGGCGGGCGGGCGCGGCGGG - Intronic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1134551981 16:15142738-15142760 GCCCGAGGGGCGGGGTGGGGGGG - Intergenic
1134554561 16:15154536-15154558 GCCAGGCGGGCGGGCGCGGCGGG + Intergenic
1134707042 16:16310347-16310369 GCCAGGCGGGCGGGCGCGGCGGG - Intergenic
1134960498 16:18401777-18401799 GCCAGGCGGGCGGGCGCGGCGGG + Intergenic
1135135835 16:19884935-19884957 GGCCCGGGGGCGGGGCCGGCCGG - Intronic
1136365242 16:29806549-29806571 GGCCGGGGTGCGCGGGCGGCGGG + Intronic
1136382037 16:29900321-29900343 GCCTGAGGGGCGGGGCCTGAGGG - Intergenic
1137263093 16:46846897-46846919 GGCCGTGGGGCGGGGGCGGGGGG - Intergenic
1137426384 16:48384857-48384879 GCCCGGGAGGCGGGCCCGGCCGG - Intronic
1137621039 16:49876720-49876742 GGGCGAGGGGCGGGAACGGCTGG + Intergenic
1137691384 16:50430396-50430418 GCCCGTGGGGCGGGGGCAACTGG - Intergenic
1138178822 16:54929188-54929210 GCCAGAGGGGCGGGGAGGGGCGG - Intergenic
1138347972 16:56331571-56331593 GCCCGAGAGGAGGCGGGGGCTGG - Intronic
1138496099 16:57410306-57410328 GCCCCTGGGGCAAGGGCGGCAGG + Intronic
1138507693 16:57486376-57486398 GCGCGGCTGGCGGGGGCGGCAGG + Exonic
1138516074 16:57536203-57536225 GCCGGACGGGAGGGGGCGGCGGG - Intronic
1139402941 16:66696653-66696675 GGGCGAGAGGCGGCGGCGGCGGG - Exonic
1139598131 16:67969662-67969684 GCGTGAGGGGCGGGGGGGTCAGG - Intergenic
1139853797 16:69965483-69965505 GCCCGAGGCCGGGGGGCGGTGGG + Intergenic
1139882775 16:70188396-70188418 GCCCGAGGCCGGGGGGCGGTGGG + Intergenic
1139917799 16:70438990-70439012 GCGCGGGCGGCGGCGGCGGCCGG - Intronic
1140078640 16:71723963-71723985 GCCGGAGGGGCGGAGCCGGCGGG - Intronic
1140369735 16:74407123-74407145 GCCCGAGGCCGGGGGGCGGTGGG - Intergenic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141682665 16:85553523-85553545 GCCCGCTGGGAGGGGGCGCCAGG + Intergenic
1142005428 16:87687556-87687578 GCCTCTGGGGCGGGGGCGGATGG - Intronic
1142156301 16:88534220-88534242 GGCCGGGCGGCGGGGGGGGCGGG - Exonic
1142206266 16:88784677-88784699 GCTGGAAGGGCGGCGGCGGCTGG - Intronic
1142240171 16:88941356-88941378 GCGCGCGGGGCGGGGGCCGCGGG - Intronic
1142253791 16:89004081-89004103 GGCCGAGGGGCAGGGGCCGCAGG + Intergenic
1142403423 16:89873119-89873141 GCTCGAGGGGCGGCGGCTCCAGG + Intergenic
1142474534 17:181258-181280 GTCGGAGGGGCTGCGGCGGCCGG + Exonic
1142484374 17:237096-237118 GGGCGTGGGGTGGGGGCGGCAGG + Intronic
1142509358 17:384815-384837 GCTGGCGGGGAGGGGGCGGCTGG + Intronic
1142509366 17:384833-384855 GCTGGAGGGGAGGGGGCAGCAGG + Intronic
1142586850 17:979420-979442 GCCCGAGCCGCGGCGGCGCCTGG - Exonic
1142670579 17:1485849-1485871 GCGCGGGAGGCGGGGGAGGCCGG - Intronic
1142858999 17:2749662-2749684 GCCGGAGGGGTGCGGGGGGCGGG + Intergenic
1143164193 17:4889814-4889836 GCACGGGGAGCAGGGGCGGCAGG - Intronic
1143484016 17:7243104-7243126 GCCGGGGAGGCGGGGCCGGCTGG + Intronic
1143702408 17:8671000-8671022 GGGCGTGGGGCGGGGGCGGGGGG + Intergenic
1143747274 17:9003595-9003617 GCCCGGGGCGCGGGCGCGGCAGG - Intergenic
1144967900 17:19089386-19089408 GGCGGACGGGCGGGGGCGGCGGG - Intergenic
1144980017 17:19162677-19162699 GGCGGACGGGCGGGGGCGGCGGG + Intergenic
1144988205 17:19215555-19215577 GGCGGACGGGCGGGGGCGGCGGG - Intergenic
1145815734 17:27793765-27793787 GCCCCCGGGGCGGGGGCTGCAGG - Intronic
1145907551 17:28524626-28524648 GGCCCAGGGCCGGGGCCGGCTGG - Exonic
1145938007 17:28726326-28726348 GCCTGAGGGGCGGGGGCAGGCGG - Intronic
1146022585 17:29292802-29292824 GGGTGAGGGGCGGGGGCGGTTGG - Intronic
1146057691 17:29589414-29589436 GCGTGGGGGGCGCGGGCGGCGGG + Exonic
1146219840 17:31008728-31008750 TCCCCAGCGGCGGAGGCGGCGGG - Intergenic
1146339544 17:32007494-32007516 GCCCGAGGGGCTGGGCGGGAGGG - Intergenic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1147006312 17:37406817-37406839 GGCCGAGGGGCGGAGGCGGCGGG + Intronic
1147132839 17:38419210-38419232 GGCGGAGGGGCGGGGCCGGCGGG + Intergenic
1147150472 17:38510975-38510997 GCCCGAGCGGCGCGGGAGGTGGG - Exonic
1147162979 17:38578703-38578725 CCCTGGGGGGCGGGGGCGGCGGG - Exonic
1147168605 17:38605715-38605737 GCGCGGGGGGCGGGGGCCCCGGG + Exonic
1147341388 17:39754858-39754880 CCCCGAGCGGCGTGGGCGGCGGG + Intergenic
1147382224 17:40062783-40062805 GGGCGGGGGGCGGGGGCGGGCGG + Intronic
1147514852 17:41105978-41106000 GCACAAGGGGCGGGGGCAGCTGG - Exonic
1147515940 17:41117749-41117771 GCACAAGGGGCGGGGGCAGCTGG + Exonic
1147516564 17:41123538-41123560 GCACAAGGGGCGGGGGCAGGTGG + Exonic
1147518867 17:41149243-41149265 GCACAAGGGGCGGGGGCAGGTGG + Exonic
1147571160 17:41571936-41571958 GCCGCAGCGGCGGGGGTGGCGGG - Exonic
1147919509 17:43907313-43907335 GGCCCAGGGGCGGGGGCGGGTGG + Intronic
1147970896 17:44218858-44218880 GCCCGGGAGGGGGGAGCGGCGGG - Intronic
1147986090 17:44308562-44308584 GGCCGAGGGGGGCGGGCGGCTGG + Exonic
1147987581 17:44315338-44315360 GCCCGGGGGGCGGGCGGGCCGGG + Intronic
1147994714 17:44354420-44354442 GCCCGGGGGGCGAGGGCGGCGGG - Exonic
1148157297 17:45431582-45431604 GTCCAAGGGGAGGGGGCGCCGGG - Intronic
1148262238 17:46193549-46193571 GCCCGCGGGGGCGGCGCGGCGGG - Intronic
1148454919 17:47806070-47806092 GCCCCAGGGGCGAGGGCAGCGGG + Intergenic
1148549994 17:48544544-48544566 GCCGGAACGGCGGAGGCGGCCGG + Exonic
1148572137 17:48678575-48678597 GCCCGAGGGAAGGCGGCGCCCGG - Intergenic
1148714239 17:49704400-49704422 GGCCGGGGGGCGGGGGTGGGGGG - Intronic
1149286562 17:55171769-55171791 GCCCCAGGGGCGGGGGAGGGAGG - Intergenic
1149512722 17:57256498-57256520 GCCGGGGGGGCGGGGACGGGGGG + Intronic
1149849325 17:60026027-60026049 GTCAGAGGGGCGGCGGCGGCCGG - Intergenic
1149860843 17:60120497-60120519 GTCAGAGGGGCGGCGGCGGCCGG + Intergenic
1149867865 17:60160795-60160817 GCCCTGGGGGAAGGGGCGGCTGG + Intronic
1150055269 17:62008681-62008703 CCTCGGGGGGAGGGGGCGGCGGG - Intronic
1150060621 17:62065441-62065463 GGCCGAGGGCCGGAGGCGGGAGG + Intergenic
1150086787 17:62277663-62277685 GCCCTGGGGGAAGGGGCGGCTGG - Intronic
1150133319 17:62680723-62680745 GCCCCGGAGGCGGGCGCGGCAGG - Intronic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1150239933 17:63622902-63622924 GCGCGAGCGGGGCGGGCGGCCGG - Intronic
1150249928 17:63699774-63699796 GGCCGAGGGGCGGGGCGGGCGGG - Intronic
1150373504 17:64661882-64661904 TCCCCGGCGGCGGGGGCGGCGGG + Exonic
1150373512 17:64661891-64661913 GCGGGGGCGGCGGGGGCGGCGGG + Exonic
1150389026 17:64780374-64780396 GCCGGGTGGGCGGGGCCGGCAGG + Intergenic
1150562059 17:66302778-66302800 GCCGGGTGGGCGGGGGCGGCGGG - Intronic
1150778610 17:68101505-68101527 GTCAGCGGGGCGGGGCCGGCGGG - Intergenic
1151475938 17:74344395-74344417 GCCTGAGGGGCAGGAGGGGCGGG + Intronic
1151652702 17:75480007-75480029 GCCCCAGAGGTGGGGGCTGCAGG + Intronic
1151657431 17:75502451-75502473 GCTTGGGGGGCGGGGGCGGGGGG + Exonic
1151783892 17:76265789-76265811 AGCCGAGGGTCGGGGGCCGCGGG + Intronic
1151954712 17:77374518-77374540 CTCCGAGGGGCGGGGGCTCCAGG - Intronic
1152030041 17:77836539-77836561 GGCGGAGTGGCGGGGGTGGCAGG - Intergenic
1152354311 17:79799297-79799319 GCTCGAGGGGCTGAGGCGGCCGG - Intronic
1152362539 17:79839348-79839370 GGGCGAGCGGCGGCGGCGGCGGG - Exonic
1152552317 17:81035705-81035727 GCCGGGGCGGCGGGGGCGGCGGG + Intronic
1152627837 17:81396393-81396415 GCCCGTGTGGCGGGGTCCGCGGG + Intronic
1152655004 17:81515152-81515174 GCCCGCGGGGCGCAGGGGGCTGG + Intronic
1152697494 17:81804309-81804331 GACCGCGGGGCGGGCGCGGCGGG + Intronic
1152704031 17:81833624-81833646 ACCCGTGGGCCAGGGGCGGCCGG - Exonic
1152704060 17:81833695-81833717 GCCCTGGGCGCGGGGGCGGGCGG + Exonic
1152711223 17:81871252-81871274 GGCGGCGGGGCGGAGGCGGCGGG - Intronic
1152721880 17:81927469-81927491 GGCGGCGCGGCGGGGGCGGCGGG - Intronic
1152729248 17:81961590-81961612 GCCCGACGGGCTGGGGGCGCGGG + Intronic
1152748518 17:82051999-82052021 GCCCCAGTGGCGGGGGGCGCGGG - Exonic
1152789895 17:82273276-82273298 GGGCGGCGGGCGGGGGCGGCGGG + Intronic
1152790023 17:82273743-82273765 GCTCCAGGGGCGGGGCCGGGCGG + Intergenic
1152809598 17:82375319-82375341 GCCCGGGCAGCGGGGGAGGCCGG + Exonic
1152924692 17:83081461-83081483 GCCCGAAGGGAGGGCGCGGTAGG + Intronic
1153805366 18:8705501-8705523 GTGCGGGGGGCGGGGACGGCGGG + Intergenic
1153851856 18:9102598-9102620 CGCCGAGGGGCGGGGGCTGACGG - Intergenic
1154160873 18:11980677-11980699 GCTCGAGCGCCAGGGGCGGCTGG - Intergenic
1154214873 18:12408315-12408337 GCGGCCGGGGCGGGGGCGGCCGG + Intronic
1154214882 18:12408333-12408355 GCCGGAGCCGGGGGGGCGGCCGG + Intronic
1154294580 18:13137342-13137364 GCGCGAGCTGTGGGGGCGGCCGG + Intergenic
1154309158 18:13254217-13254239 GCCCGAGGCCCAGGGGAGGCAGG + Intronic
1154940789 18:21111368-21111390 GCCCGAGCGGCGGCCGCAGCTGG - Exonic
1155257872 18:24014487-24014509 GGCCGGGGCGCGGGGGCTGCAGG + Intronic
1155368964 18:25078147-25078169 GCCCGAGACTCTGGGGCGGCTGG + Intronic
1156099733 18:33578719-33578741 GGGCGAGCGGCGGGGCCGGCGGG - Intronic
1157222496 18:45837941-45837963 GCCCTTGGGGCGGGGCAGGCGGG - Intronic
1157353988 18:46917116-46917138 GCGGGCGGCGCGGGGGCGGCGGG - Intronic
1157700323 18:49758129-49758151 GCAGGTGGGGCGGGGCCGGCAGG + Intergenic
1157867157 18:51197106-51197128 GCCCGAAGCGCCGGGGCGCCGGG + Exonic
1158435943 18:57435670-57435692 GCGGGGGCGGCGGGGGCGGCCGG - Exonic
1158893577 18:61894260-61894282 GCCGGAGGAGCGGCGGCCGCCGG - Intergenic
1159670148 18:71212523-71212545 CGGCGGGGGGCGGGGGCGGCGGG + Intergenic
1160080757 18:75725218-75725240 CCCTGTGGGGCGGGGGCGGGGGG - Intergenic
1160163278 18:76491415-76491437 GGCCGGGGGGCGGGGGCGGGCGG - Intronic
1160163335 18:76491564-76491586 CGCCGGGGGGCGGGGGCGGCGGG + Intronic
1160680977 19:411493-411515 GCCCGAGGAGAGGGGGCCTCAGG + Intergenic
1160691437 19:462055-462077 GCCCGCGGGGCCGGGGAGGTGGG + Intergenic
1160719113 19:589867-589889 GCCCGAGGGAGGGGGGAGGCGGG - Intergenic
1160738784 19:676539-676561 GCCAGAGGGGCGGGCGGGGCGGG + Intronic
1160739845 19:680672-680694 GCTGGAGGGGCGGGGCCTGCTGG + Intronic
1160790468 19:920594-920616 GTCCGAGGGTCCGGGCCGGCGGG - Exonic
1160847622 19:1173487-1173509 GCCCCAGGAGCGGGAGGGGCGGG + Intronic
1160863715 19:1248443-1248465 GCCCCAGGGCCAGGGCCGGCAGG + Intergenic
1160868597 19:1266907-1266929 GGCCGAGGCGCGGGGGCGGCGGG + Intronic
1160871700 19:1280755-1280777 GAGCGGGGGGCGGCGGCGGCTGG - Intergenic
1160873837 19:1288306-1288328 GCCTGAGTGGCGGGGGTGTCAGG + Intronic
1160899173 19:1418551-1418573 GCCGGCGGGGCGGGGCGGGCCGG + Intronic
1160930463 19:1567638-1567660 GCCGGGGCGGCGGCGGCGGCGGG + Exonic
1160939666 19:1614386-1614408 GCCCGAGCACCGGGAGCGGCTGG - Intronic
1160949564 19:1658902-1658924 GGCCAGGGGGCGGGGGCGGGTGG + Intergenic
1160961881 19:1725778-1725800 GCCGGGGGGGCGGGGTCGGGCGG - Intergenic
1160965919 19:1746840-1746862 GCCCGAAGGGCTGGGTCGGAGGG + Intergenic
1161026173 19:2038424-2038446 ACCCGCGGGGAGGGGGCAGCAGG + Exonic
1161029143 19:2050034-2050056 GCCTGAGGGGTGGGGCGGGCCGG + Intronic
1161104159 19:2434966-2434988 GGCGGGTGGGCGGGGGCGGCCGG - Intronic
1161165574 19:2785508-2785530 GCCCCGGGAGCGCGGGCGGCGGG + Exonic
1161206183 19:3042317-3042339 GGCAGAGGGGCGGAGGTGGCGGG + Intronic
1161233324 19:3186350-3186372 GCCCGGGGGTCCAGGGCGGCAGG - Intronic
1161249032 19:3270686-3270708 GGCCGCGGGGTGGGGACGGCCGG + Intronic
1161299916 19:3537622-3537644 GCCGGGGGGCCGGGGGCTGCAGG + Intronic
1161318614 19:3630931-3630953 TGCCGAGGGGCGGGGGCAGGAGG - Exonic
1161471221 19:4457565-4457587 CCCTGCGGGGCGGGGACGGCCGG - Intronic
1161677664 19:5661569-5661591 GCGCGAGGAGCGTGAGCGGCTGG + Exonic
1161683355 19:5691470-5691492 GGCCGAGGGGCGGGGTGGGATGG + Intronic
1161702973 19:5805056-5805078 GCGGGACGGGCGGAGGCGGCGGG + Intergenic
1161723855 19:5917532-5917554 GCCGGTGGGGTGGGGGCGGGTGG + Exonic
1161920196 19:7260316-7260338 GCCAGAGGGGTGGGTGAGGCCGG - Intronic
1161959544 19:7516188-7516210 GCCCGGGGGGAGCCGGCGGCCGG + Exonic
1162373535 19:10292423-10292445 GCCCGAGGGGCGGGGCAGGTGGG + Intronic
1162403127 19:10457958-10457980 GTACAGGGGGCGGGGGCGGCTGG - Exonic
1162445074 19:10718034-10718056 GCCCCCGGGGCCGGGGCGGGAGG + Intergenic
1162572426 19:11480936-11480958 GACCGAGGGGCGGCGGCGAAAGG - Exonic
1162781661 19:13010018-13010040 GCCCCTGGGGCGGTGGAGGCGGG - Intronic
1162818184 19:13208512-13208534 GGCGGCGGGGAGGGGGCGGCGGG + Intronic
1163442074 19:17327406-17327428 GCGACAGGGGCGGGGGCAGCTGG - Intronic
1163462729 19:17448558-17448580 CCCCGAGGGGGCGGGGCCGCAGG + Exonic
1163551182 19:17967176-17967198 GCGCGGGGCCCGGGGGCGGCGGG - Intronic
1163583740 19:18153309-18153331 GCCCTCGTGGCGGGGGCGGCTGG + Intronic
1163583875 19:18153754-18153776 GCGGGAGGGGCGGGGCAGGCAGG - Intronic
1163587884 19:18173724-18173746 ACCCGAGGGGCGTGGGCATCGGG + Exonic
1163665853 19:18603885-18603907 GGCCGAGGGGGGCGGGGGGCTGG + Intronic
1164989632 19:32674843-32674865 ACCCGAGGGGCGGAGTGGGCAGG + Intronic
1165096172 19:33411064-33411086 ACCCGAGGGGCGGAGGCCGCAGG + Intronic
1165129437 19:33622627-33622649 GCCCGCGGGGAGGCGGCGTCGGG + Intronic
1165213666 19:34254522-34254544 GCCCGAGGCGGGGGCGGGGCCGG + Exonic
1165311350 19:35030867-35030889 GCGCGGGGGGCGCGCGCGGCCGG + Intronic
1165349785 19:35269304-35269326 GGCCGGGGGCCGGGGGCGGGAGG - Intronic
1165773310 19:38390416-38390438 GCCCGAGGGGGGGGCCCGCCAGG + Exonic
1165775613 19:38402961-38402983 AGCCGAGGGGCGGGGCGGGCGGG + Intergenic
1166072533 19:40395401-40395423 GCCAAAGGGGCTGGGGAGGCAGG - Exonic
1166112216 19:40629572-40629594 CCCCGAGTGGCGGGCGCGGGTGG - Exonic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1166288066 19:41844687-41844709 GCCCCAGGGGCGGGGCCAGGCGG + Intronic
1166316798 19:41993984-41994006 GCGCGGGGGGCGGGGGCACCGGG - Intronic
1166765775 19:45251556-45251578 TCCCGGGGGGCAGGGGCGGCCGG - Exonic
1166807281 19:45494815-45494837 GCCCTGGGGGCGGGGGCGGCGGG + Exonic
1166834576 19:45659364-45659386 GCTGGAGGGCCGGGGGAGGCAGG + Intergenic
1166888250 19:45973941-45973963 GCCCGGGGGGCGGCGGGCGCGGG + Intergenic
1167103837 19:47419317-47419339 GCCGCCGGGGCGGGGGCAGCAGG + Intronic
1167268281 19:48493971-48493993 GCCGGCGGGGCGGGAGCGCCGGG - Exonic
1167284095 19:48589115-48589137 GCCCGAGAGGCGGCGCTGGCCGG + Intronic
1167369655 19:49072835-49072857 GCGCGGGCGGCGGCGGCGGCGGG - Exonic
1167577152 19:50323191-50323213 GCGGGTGGGGCGGGGGTGGCGGG + Exonic
1167613321 19:50517661-50517683 ACCCCAGCGGCGGGGGCTGCGGG - Exonic
1167643660 19:50694961-50694983 GCGCGGGGGGCGGCTGCGGCAGG + Intronic
1167738686 19:51311715-51311737 GCCCGGGGGGCGGCGGGGGCGGG - Intergenic
1167748413 19:51366386-51366408 GCGCGGGGGGCGGGGGTGGTGGG - Intronic
1167983860 19:53299116-53299138 GCCTGAGGGGCGGGGTCCCCAGG - Intergenic
1168098674 19:54129315-54129337 GCCCGAGGAGCGGTCGCGGATGG - Exonic
1168119477 19:54243550-54243572 GCCCGGGAGGCGGAGGCTGCAGG + Intronic
1168280819 19:55304648-55304670 GCCCCAGGGGTGGGGGCGCCGGG + Exonic
1168315337 19:55482496-55482518 GGCGGCGGGACGGGGGCGGCAGG - Exonic
1168336542 19:55600411-55600433 ACCCGAGAGGCGGGGGGCGCAGG + Intronic
1168401423 19:56087993-56088015 GCCCGGGGGGGGGGGCGGGCAGG - Exonic
1168414427 19:56159620-56159642 GCCCCAGGGGCGGTGCCTGCTGG - Exonic
1168536056 19:57171983-57172005 GTCCGGGGGGCGGGGGCCGCGGG + Intergenic
925959717 2:9003632-9003654 GGGCGAGCGGCGCGGGCGGCCGG - Exonic
926035191 2:9630760-9630782 GCCGGCCGGGCGGGGGTGGCGGG - Intronic
926089879 2:10043202-10043224 GGCGGGGCGGCGGGGGCGGCGGG - Intronic
926101844 2:10122902-10122924 GCCCGCGGGGAGGGCGCTGCGGG + Intronic
926167863 2:10532691-10532713 GACCGAGGGGCCGGGGAGGGCGG + Intergenic
927142471 2:20139766-20139788 GCCTGGGGGGCTGGGGCTGCGGG + Intergenic
927261408 2:21095079-21095101 GCCGGAGGGGGGGGGGGGGGTGG - Intergenic
927606569 2:24491510-24491532 GCCCGAGGAGCGGCGGAGGCCGG + Intergenic
927606591 2:24491581-24491603 GGCCCAGAGGCGGCGGCGGCAGG + Intergenic
927714132 2:25341666-25341688 GCCCGTGGGGCCGGGACTGCAGG - Intronic
927982261 2:27381388-27381410 GCCCGAGGAGCAGAGGCGGCTGG + Exonic
928549520 2:32357291-32357313 GCGGCGGGGGCGGGGGCGGCCGG + Exonic
928998744 2:37324847-37324869 GCGCGGGGGGCGGGGGCGCGCGG + Intergenic
929188602 2:39120448-39120470 GGGAGAGGGGCGGCGGCGGCCGG + Exonic
929252893 2:39779125-39779147 GCGAGAGGTGCGGGCGCGGCTGG - Exonic
929779777 2:44949963-44949985 GCCCGAGGGAGGGCGGGGGCAGG + Intergenic
929874035 2:45781631-45781653 GGCCGGGGGGCGGGCGCGGGTGG - Intronic
929966824 2:46542786-46542808 CGCCGAGTGGCGGGGGCAGCGGG + Exonic
929966853 2:46542875-46542897 GCAGGAGGGGAGGGGGCGGCGGG - Exonic
930071381 2:47369255-47369277 GGCCGAGAGGCGGGGCCGCCAGG + Exonic
931253776 2:60553842-60553864 GGCCGAGGGGAGGGGGCGCTGGG + Intergenic
932129823 2:69177812-69177834 CCCCGAGTGGTGGGGGTGGCCGG - Intronic
932180712 2:69643742-69643764 GCGCGCGGGGGAGGGGCGGCGGG - Intronic
932567745 2:72920173-72920195 CGCCGAGGGCCGGGGGCGCCTGG + Intronic
932780603 2:74556327-74556349 GCCTGAGGGGCAGCGGCGGCCGG - Exonic
933374995 2:81467532-81467554 GCCCCCGGGGCGAGGGCAGCTGG + Intergenic
933728074 2:85437667-85437689 GGCCAGGGGGCGGGGGCGTCTGG + Intergenic
933744562 2:85561314-85561336 CTCAGAGGGGCGGGGGCGGGAGG - Intronic
933876118 2:86623360-86623382 GCCCGAGGGGCCGTGGGGGCCGG + Exonic
934856481 2:97733232-97733254 GGGCGGTGGGCGGGGGCGGCAGG + Intronic
935592764 2:104856353-104856375 GCGCGTGGTGCGGGTGCGGCGGG - Exonic
935971478 2:108534353-108534375 GGGGGAGGGGCGGGAGCGGCTGG - Intronic
936228232 2:110677919-110677941 GCCCAGGGGGCTGGGGCGCCTGG - Intronic
936384848 2:112020183-112020205 GCCCTAGGGGCAGGGTCGGCTGG - Intronic
936568149 2:113595847-113595869 GGCCGAGGGGTGTGGGCGGGAGG + Intergenic
937183138 2:120013448-120013470 GCGCGACGGGCCGGGGCGGAGGG + Intronic
937221674 2:120345929-120345951 GCCCGAGGGGCGCGCCGGGCGGG - Intergenic
937288411 2:120767355-120767377 GCGCTGGGGGCGGGGGCGGGTGG + Intronic
937360687 2:121227854-121227876 GTGGGAGGGGCGGGGGCGACAGG - Intronic
937950873 2:127387502-127387524 GGCGGAGGGGCGGGCTCGGCGGG - Intronic
937993168 2:127675199-127675221 GCCCGCGGGGCGGGGTGGGATGG + Intronic
938014782 2:127858190-127858212 CCCCGAGGGGTGGGCGGGGCCGG + Intergenic
938074083 2:128322729-128322751 GCCAGCAGGGCGGGGGGGGCGGG - Intergenic
938077218 2:128346239-128346261 GCCCCAGGGGCAGGGGCAGGTGG + Intergenic
938108370 2:128548554-128548576 GCCTGAGGGGTGGAGGCGGGAGG - Intergenic
938296595 2:130182800-130182822 GCCCCAGTGGCGGGGGTGGCGGG + Intronic
938301107 2:130213643-130213665 GCCGGAGGGGAGGGGGCGGCGGG + Intergenic
938418426 2:131123781-131123803 GGCCGAGGGCGGGGGGCGGGGGG - Intronic
938455580 2:131460735-131460757 CGCCGAGTGGCGGGGGCAGCGGG + Intergenic
938455610 2:131460824-131460846 GCCGGAGGGGAGGGGGCCGCGGG - Intergenic
938460153 2:131491829-131491851 GCCCCAGTGGCGGGGGTGGCGGG - Intronic
941951495 2:171160834-171160856 GCCCGGGAGGCGGCGGCGGCGGG + Intronic
942151066 2:173076161-173076183 GCCCGCCCGGCGGCGGCGGCCGG + Intronic
942178200 2:173355004-173355026 ACCCGAGGGGCGGGCGCGGTGGG + Intronic
942342494 2:174962660-174962682 GCCCGGGGGGGGGGGGGGGGGGG + Intronic
943060479 2:183037904-183037926 GGCCGTGGGGTGGGGGCGGCAGG - Intronic
943089201 2:183353772-183353794 GCACGGGGGGCTGGGGAGGCAGG + Intergenic
944414484 2:199468767-199468789 GCCTGAGGGGCGGGGGCTGCTGG - Intronic
944715894 2:202376114-202376136 GAACGAGGGGCGGGGCCGGGCGG + Intergenic
944715979 2:202376443-202376465 GACCGAGGGCGGGGGGCGGCGGG - Intergenic
945234985 2:207625347-207625369 GCCCGCGACGCGGGGGCGGGCGG + Intronic
945833120 2:214809697-214809719 GCCAGAGGGGCGGGGCGCGCGGG + Exonic
946019856 2:216633600-216633622 GCGCGAGTGGCGGCGGCGGCGGG + Exonic
946185762 2:217979632-217979654 GCCCTGGGGGGTGGGGCGGCAGG - Intronic
946301666 2:218827951-218827973 CCCAGAGGGGCGGGGGCGGAGGG - Intronic
946308744 2:218871380-218871402 GCCCCAGGGGCCTGGGAGGCAGG - Intronic
946416920 2:219544307-219544329 GCCCGAGGGGCCGGGGTTGCGGG - Exonic
946692478 2:222319729-222319751 GCCAGGGCGGCGGGCGCGGCGGG + Intergenic
946865673 2:224039347-224039369 GGGCCGGGGGCGGGGGCGGCAGG - Intergenic
947761144 2:232604729-232604751 GCCCTGGAGGCGGGGTCGGCTGG - Intergenic
947800934 2:232928208-232928230 GCGGGAGGGGCGCGCGCGGCGGG + Intronic
947800950 2:232928244-232928266 GGCGGCGGGGCGGGGGCGCCCGG + Intronic
948116035 2:235494632-235494654 GGGCGCGGGGCGGCGGCGGCGGG + Exonic
948153626 2:235764661-235764683 GCCCGTGGGGTGGGGGCATCTGG + Intronic
948153637 2:235764688-235764710 GCCCGTGGGGTGGGGGCATCTGG + Intronic
948153648 2:235764715-235764737 GCCCGTGGGGTGGGGGCATCTGG + Intronic
948153659 2:235764742-235764764 GCCCGTGGGGTGGGGGCATCTGG + Intronic
948403015 2:237697807-237697829 GACTGAGAGGCGAGGGCGGCTGG - Intronic
948458928 2:238119875-238119897 GCCCCAGGGGCTGGGGTGGGGGG - Intronic
948473799 2:238203647-238203669 GGGCGACGGGCAGGGGCGGCCGG + Exonic
948492140 2:238320557-238320579 GACCGGGCGGCGGCGGCGGCGGG + Exonic
948560409 2:238847918-238847940 CGCCGGGGGGCGGGGGCGGCCGG + Intergenic
948901972 2:240960692-240960714 GCCCCAGAGGCCGGGCCGGCCGG + Intronic
948940366 2:241192401-241192423 GCCCGAGGTGAGGGTGAGGCAGG + Intronic
949004294 2:241636841-241636863 ACGCGGGGGGCGGGGGCGCCGGG - Intronic
949014622 2:241702278-241702300 GCGCGGGGGGCGGGCGCGGGGGG + Intronic
1168777746 20:462270-462292 GCCCGGGGGGCAGGGGCAGCTGG - Intronic
1168804450 20:664214-664236 GGCGGCGGGGCGGGGGCGGCGGG - Exonic
1169194873 20:3677678-3677700 GCCGGAGGGACGGGGGCTGCTGG - Intronic
1169204582 20:3732629-3732651 GGCCTGGGGGAGGGGGCGGCGGG + Intergenic
1169438078 20:5611036-5611058 CCCCGCGGGGCGGGGCCGGAGGG + Intergenic
1169758610 20:9068398-9068420 GCCCAAGGGTCGGGGGCGCACGG - Intergenic
1169863013 20:10172153-10172175 GCCCGAGGGGTGGGGGTGGCCGG - Intergenic
1170156619 20:13274673-13274695 GCCCGGGGGCCGGGCGCGGGGGG - Intronic
1170756792 20:19212461-19212483 GGCCGGGAGGCGGGGGCGGAGGG - Intergenic
1170756801 20:19212478-19212500 GCGGGGGCGGCGGGGGCGGCCGG - Intergenic
1170756805 20:19212487-19212509 GGCGGCGCGGCGGGGGCGGCGGG - Intergenic
1171427779 20:25059003-25059025 CCCTGGGGGGCGGGGACGGCGGG + Intergenic
1171810439 20:29742060-29742082 GCCCGTGGGTCGGGTGCGGTGGG - Intergenic
1172091272 20:32434649-32434671 GCCCGGGTGGAGGTGGCGGCGGG + Exonic
1172483300 20:35284490-35284512 GGCCTAGGGGCGGCGGAGGCGGG + Exonic
1172848418 20:37944170-37944192 GGCGGCGGGGCGGGCGCGGCGGG - Exonic
1173221883 20:41137936-41137958 GCCCAAGTCGCTGGGGCGGCCGG - Intronic
1173528333 20:43749858-43749880 GCCCTTGGGGCGCCGGCGGCCGG + Intergenic
1174287262 20:49482488-49482510 GCAGGGGGGGCGGGGGCGGCCGG - Exonic
1174305899 20:49614103-49614125 GTGCCAGGGTCGGGGGCGGCAGG + Intergenic
1174330407 20:49812963-49812985 TCCCGGGCGGCGGAGGCGGCGGG + Intronic
1174736669 20:52972104-52972126 GCGGAAGGGGCGGGGGCGGGAGG - Intergenic
1174804319 20:53593347-53593369 GCCCTTGGGGCGCGGGCGGAGGG - Intronic
1174898505 20:54475371-54475393 GGGCGAGGTGCGGGGGTGGCGGG + Intergenic
1175210446 20:57350870-57350892 GGACGGGGGGCGGGGGGGGCGGG + Intergenic
1175210453 20:57350879-57350901 GCGGGGGGGGCGGGGGGGGCGGG + Intergenic
1175219579 20:57409147-57409169 GGCCGAGGGCGGGGGGCAGCGGG + Exonic
1175268988 20:57720440-57720462 GCCCGCGGGGGGGGGGTGGGGGG + Intergenic
1175399542 20:58692759-58692781 CCCGGAGCGGCGGGGGAGGCGGG + Exonic
1175443791 20:59007236-59007258 GCCCAAAGTGCGGGGTCGGCCGG - Exonic
1175735927 20:61386887-61386909 GCCCGGGGGGAGGAGGCGTCAGG + Intronic
1175807542 20:61838165-61838187 GCCCAAGGGGCAGGGGAGACAGG - Intronic
1175847088 20:62064969-62064991 GCCAGAGTGGCGGGCGCGGGGGG + Exonic
1175847212 20:62065311-62065333 GCCAGCGCGGCGGGGCCGGCGGG + Exonic
1175916904 20:62430257-62430279 ACCTGAGGGGCTGGGGCTGCTGG + Intergenic
1175958691 20:62624195-62624217 GCCAGAGGGGCAGGGGCTGCAGG + Intergenic
1176039097 20:63055068-63055090 ACCAGAGGGGCCGGGGCAGCCGG + Intergenic
1176135632 20:63520928-63520950 GCCCGAGGGGCGGGGGGCGAGGG + Intronic
1176148044 20:63574142-63574164 GGCGGAGGGGCGGGGGCGCGGGG - Intronic
1176178112 20:63738068-63738090 GAGGGCGGGGCGGGGGCGGCCGG + Intronic
1176194566 20:63831285-63831307 GCGCGGGCGGCGGGGGCCGCGGG - Intergenic
1176273138 20:64246825-64246847 GGCCAAGGGGCAGGGGCAGCGGG + Intergenic
1176286803 21:5022833-5022855 GGCGGAGGCGCCGGGGCGGCCGG + Intronic
1176450739 21:6858909-6858931 ACCCTAGGTGCGGGGGAGGCGGG + Intergenic
1176733660 21:10522439-10522461 GCCCTTGGGGCGCGGGCGGAGGG + Intronic
1176828908 21:13723927-13723949 ACCCTAGGTGCGGGGGAGGCGGG + Intergenic
1176952536 21:15064538-15064560 TCGCGGGGGGCCGGGGCGGCGGG - Intronic
1178914586 21:36699404-36699426 TCCTGGGGGGTGGGGGCGGCCGG - Exonic
1178961922 21:37073337-37073359 GTCCGAGGCTCGCGGGCGGCGGG + Intronic
1179729093 21:43357546-43357568 GGACGTGGGGCGGGGGCTGCAGG + Intergenic
1179819955 21:43930857-43930879 GCCCGAGGGGACAGGGCAGCAGG - Intronic
1179833427 21:44012451-44012473 GCCCATGGGGCGCGGGGGGCCGG + Exonic
1179870378 21:44240642-44240664 GGCGGAGGCGCCGGGGCGGCCGG - Intronic
1179882428 21:44299048-44299070 GCCCGTGGGGTGGGGGGGGGGGG - Intergenic
1180084989 21:45504501-45504523 GCCTGGGGGGCCGGGGGGGCCGG - Exonic
1180156387 21:45979418-45979440 GTCCGCGGGGTGGGTGCGGCGGG - Intergenic
1180201747 21:46228816-46228838 GCGGGAGGGGCGGGAGGGGCGGG - Exonic
1180201752 21:46228825-46228847 GCGGGAGGGGCGGGAGGGGCGGG - Intergenic
1180201757 21:46228834-46228856 GCGGGAGGGGCGGGAGGGGCGGG - Intergenic
1180558961 22:16601096-16601118 GCCCGCAGGGCGAGGGCAGCCGG - Intergenic
1180560240 22:16609770-16609792 GCCCTTGGGGCGCGGGCGGAGGG - Intergenic
1180631359 22:17232453-17232475 GCCGGTGCGGCGGGGGCGGGGGG - Intergenic
1180791429 22:18577542-18577564 CCCGGAGGGGCGCGGGCGGTGGG - Intergenic
1180831898 22:18910863-18910885 GCCGTGGGGCCGGGGGCGGCGGG - Intronic
1181032460 22:20155074-20155096 GGGAGAGGGGCGGGGGCGTCAGG - Intergenic
1181064471 22:20299101-20299123 TCCCGAGGAGAGGGCGCGGCTGG + Intergenic
1181064506 22:20299211-20299233 TCCCGAGGAGCGGGCGCGGCTGG + Intergenic
1181064520 22:20299251-20299273 TCTCGAGGAGCGGGCGCGGCTGG + Intergenic
1181230310 22:21417769-21417791 CCCGGAGGGGCGCGGGCGGTGGG + Intronic
1181248340 22:21517094-21517116 CCCGGAGGGGCGCGGGCGGTGGG - Intergenic
1181283400 22:21735754-21735776 GCCCGCGGGGCGGCGGCGGGAGG - Exonic
1181283447 22:21735917-21735939 GCGCGCGGGGCGGGGGCGCGCGG - Intergenic
1181366444 22:22380571-22380593 GCGCGGGGGGCGGGGGTGGGCGG + Intergenic
1181793196 22:25283351-25283373 GGCCGGGGGGAGGGGGCGACAGG - Intergenic
1181831640 22:25564900-25564922 GCGCGCGGGGCGGGGGCGCGCGG + Exonic
1181831672 22:25564961-25564983 GCGCGGCGGGCGGCGGCGGCGGG + Exonic
1181902815 22:26169771-26169793 CCCCGAGGGGCGGGGCGGGCAGG + Intronic
1182236972 22:28883727-28883749 GCGCGGAGGGCGGGCGCGGCCGG - Exonic
1182355300 22:29720116-29720138 CACCGAGGAGCGGGCGCGGCGGG + Exonic
1182355346 22:29720251-29720273 GCCCGGGGCGCGGGGGCGCTAGG + Exonic
1182355463 22:29720598-29720620 GCCAGGGGCGCGGGGGCGGGGGG + Intronic
1182532319 22:30969669-30969691 GCCGGGGAGGCGGGGGTGGCCGG + Intergenic
1183093687 22:35540324-35540346 GCGCGTGGGGCCGGGGCCGCTGG - Intergenic
1183309423 22:37101419-37101441 GCCCGAGGAGAGGGTGTGGCTGG - Intronic
1183395598 22:37569142-37569164 GCCCGTGGGGGGTGGGGGGCAGG + Exonic
1183427196 22:37746282-37746304 GCCGGAGGCGCGGCGGCGGGCGG + Intronic
1183535342 22:38398021-38398043 GCCCTTGGGGCGCGGGCGGAGGG - Intronic
1183546269 22:38456005-38456027 GGCCGAGGGGCGGGCAGGGCGGG - Intergenic
1183683649 22:39349848-39349870 GCTCGCGGGGCGCGGGCGGGGGG - Intergenic
1183743157 22:39679368-39679390 GGCCGAGGGCCGGGAGGGGCGGG + Exonic
1183788406 22:40045198-40045220 GCGCGCGGGGCTGGTGCGGCCGG + Intronic
1183942280 22:41302358-41302380 GCCCGCGGGAAGGGGGCGGCAGG + Intronic
1184004753 22:41699866-41699888 GCCCGAGAGGCCGCTGCGGCCGG - Intronic
1184232154 22:43163956-43163978 GGCCGAGGGGAGGGAGCCGCGGG - Intergenic
1185272696 22:49936096-49936118 GAGCGCGGGGCCGGGGCGGCGGG - Intergenic
1185278598 22:49960584-49960606 GGGCGAGGGCCGGGTGCGGCGGG - Exonic
1185278622 22:49960654-49960676 GCCCGCGAGGCGGCGGCGGCCGG - Exonic
1185278856 22:49961379-49961401 GCACGGGCGGCGGCGGCGGCGGG + Intronic
1185287904 22:50010686-50010708 GCCCGAGTGTCTGGGGCTGCAGG + Intronic
1185321171 22:50200847-50200869 GCCGGAGGGTCGGAGGCGTCCGG - Intergenic
1185338479 22:50281294-50281316 GCCAGAGGGGCCGAGGCGGGAGG + Intronic
1185385641 22:50530301-50530323 GCCCGAGCGTCGGGCGAGGCCGG - Intronic
1185397653 22:50600966-50600988 GGCGGCGGGGCTGGGGCGGCGGG - Intronic
1185409416 22:50674364-50674386 TCCCCGGGGGCGGGGGCGGCGGG - Intergenic
1185420196 22:50730768-50730790 GCCCCGGGGGCCCGGGCGGCGGG + Intergenic
1203281976 22_KI270734v1_random:136134-136156 GCCGTGGGGCCGGGGGCGGCGGG - Intergenic
949970000 3:9396754-9396776 GCGCGGGGCGCGGGGGTGGCGGG - Intergenic
949993741 3:9600673-9600695 GGCCGGGGGGCGGGGGCGCTGGG + Intergenic
950004482 3:9682938-9682960 ACTCGGGGGGCGGGGGCGGGGGG - Intronic
950400979 3:12768933-12768955 GCGGGGGGGGCGGGGGGGGCGGG + Intronic
950496004 3:13334995-13335017 GCCTGCGGGGCAGGGGCTGCAGG - Intronic
950730103 3:14948611-14948633 GCGCGAGGGGCGCGGCCGGGTGG + Intronic
951078691 3:18425775-18425797 GCGCGCGGCGCGCGGGCGGCAGG + Intronic
952916436 3:38248335-38248357 GTGCTAGGGGCGGGGGGGGCGGG - Intronic
953246516 3:41199136-41199158 ACGCGCGGGGCGGGGGCGTCGGG + Intronic
953352952 3:42229816-42229838 GCCAGAGCTGCGGGGGAGGCTGG - Intergenic
953406980 3:42664511-42664533 GCAGGTGGGGCGGGGGCGGCAGG - Exonic
953562065 3:43999251-43999273 TCGCGGGGGGCGGGGGCGGGCGG - Intergenic
953680667 3:45035924-45035946 GCCGGCGGGGCGGGGGCCGTGGG + Exonic
953705343 3:45226243-45226265 GCCCCGGCGCCGGGGGCGGCGGG - Exonic
953912296 3:46899221-46899243 GGCTGGGGGGCTGGGGCGGCAGG - Intronic
954332040 3:49896292-49896314 GCCCGAGGGGATGGAGCTGCTGG - Exonic
954632862 3:52056480-52056502 GGCCGGGAGGCCGGGGCGGCGGG - Exonic
955186056 3:56716596-56716618 GCGGGGGGGGCGGGGGGGGCTGG - Intergenic
955407651 3:58635634-58635656 GGCCGGTGGGCGGGGGCGGCCGG - Intronic
956422460 3:69099119-69099141 GGCTGAGGGGCGGGGGGGGTGGG + Intronic
956628031 3:71286305-71286327 GCGGGCGGGGCGGGGGTGGCGGG - Intronic
956681466 3:71785323-71785345 GCCCGAGGCGGGGGCGCGGGGGG - Intergenic
959984903 3:112561685-112561707 GGACGAGGGGGCGGGGCGGCAGG + Exonic
960902227 3:122564444-122564466 GCACGAGGAGCGGGGACGGCGGG - Exonic
960996759 3:123345280-123345302 GGCCGAGGCGCAGGGGTGGCCGG + Intronic
961013399 3:123449807-123449829 GCCCGGGCGGCGCGGGGGGCGGG - Intergenic
961202508 3:125055923-125055945 GCGCGCGGGGCGAGGGCAGCGGG + Exonic
961305612 3:125958066-125958088 GCCCTGGGGGGGGGGGCGGGGGG - Intergenic
961359108 3:126356473-126356495 GACCGAGGGATGGCGGCGGCGGG - Intronic
961365187 3:126395063-126395085 GCCCGAGGGGCGCGCGTGGCCGG + Intronic
961404511 3:126668723-126668745 GCCTGCGGGGCAGGGGCCGCAGG + Intergenic
961539553 3:127590435-127590457 GCCGGGGCGGCCGGGGCGGCCGG - Exonic
961674434 3:128555929-128555951 GCTCCAGGGGCGGGGGGCGCTGG - Intergenic
961827529 3:129606763-129606785 GCGCCGGGGTCGGGGGCGGCTGG - Exonic
963040451 3:141066194-141066216 GCCCGGGCGGCCGGCGCGGCTGG + Exonic
963673514 3:148280781-148280803 GCCCCGGGCGCGGGGCCGGCTGG + Intergenic
964570564 3:158105026-158105048 GGGCGGGGGGGGGGGGCGGCGGG - Intronic
964801679 3:160565174-160565196 GCCGGAGGGGTGGGGGCTGTGGG - Intronic
965404144 3:168249575-168249597 TCCGGAGGGGCTGGGGCGGGAGG + Intergenic
965520134 3:169662777-169662799 GCCACAGTGGCGGCGGCGGCGGG - Intronic
966594315 3:181712311-181712333 GGCCGAGGGTCGGCGGCCGCCGG + Exonic
966852079 3:184170614-184170636 GCCCCATGGCCGCGGGCGGCGGG - Exonic
966852815 3:184175107-184175129 GACGGTGGGGCGGGGGCGCCCGG + Intronic
966874660 3:184315135-184315157 GCCCGGAGGGCGGGCGGGGCCGG - Intronic
966883603 3:184362730-184362752 GCCCGGGGGAGGGGGGTGGCGGG + Intronic
966924909 3:184638428-184638450 GCCTGAGGGGCTGGGGTGTCTGG + Intronic
967924248 3:194633576-194633598 GCCGGAGCGGGGCGGGCGGCTGG + Intronic
968471823 4:786087-786109 GCGGGCGGGGCGAGGGCGGCGGG - Exonic
968479233 4:826333-826355 GACCCGGGGGCGGGGGCGGGGGG + Intergenic
968479244 4:826346-826368 GGGCGGGGGGCGGGGGCGGGGGG + Intergenic
968479287 4:826418-826440 GACCCGGGGGCGGGGGCGGGGGG + Intergenic
968479432 4:826786-826808 GGCAGAGGGGTCGGGGCGGCGGG - Intergenic
968501034 4:950176-950198 GCTGGAGGGGTGGGGGCTGCAGG + Intronic
968514910 4:1011843-1011865 GCCCGGGGGCGCGGGGCGGCGGG + Intronic
968571969 4:1346803-1346825 GCGCCGGGGGCGGGGCCGGCCGG - Intergenic
968583733 4:1406451-1406473 GCCCGAGCCGCCGGAGCGGCGGG - Intergenic
968584025 4:1407658-1407680 GGCCGAGGGCCGCGGGCCGCAGG - Intergenic
968606008 4:1536121-1536143 ACCCGAGGGGCAGGAGAGGCCGG - Intergenic
968660085 4:1795241-1795263 GCCGGAGGGGCGGCCGCGGGGGG + Intronic
968701281 4:2059347-2059369 GGGCGCGGGGCGGAGGCGGCGGG - Intergenic
968701451 4:2059905-2059927 GCCCGAGGGACTGCGGCAGCCGG - Intronic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
968831445 4:2934564-2934586 GCGCGCGGGGTGGGGGCGGTGGG - Intronic
968845051 4:3036335-3036357 CCCCGAGGGGCGGGGCCTGCCGG + Intronic
968870750 4:3240921-3240943 GCCCGAGGAGGAGGGGCTGCAGG - Exonic
968965543 4:3767479-3767501 GGCCGAGAGGCGGCGGCGCCGGG + Exonic
968969683 4:3787252-3787274 GCCAGAGGGGAGGGGGAGGGAGG - Intergenic
969330747 4:6472375-6472397 GGGGGACGGGCGGGGGCGGCCGG + Intronic
969400787 4:6954111-6954133 GGCGGAAAGGCGGGGGCGGCAGG - Intronic
969586750 4:8098204-8098226 GCCAGAGGGGCTGGGGCTGCAGG - Intronic
969651652 4:8471653-8471675 GCCCGTGGGGCGAGGGCCACAGG - Intronic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
971457373 4:26857713-26857735 TCCCGACTGGCGGGCGCGGCAGG - Intronic
972396622 4:38663991-38664013 GCGCGGGAGGCGGGGGTGGCGGG + Intergenic
972437132 4:39045023-39045045 GCGGGAGGAGCGGGGGAGGCGGG - Intronic
973613593 4:52659008-52659030 GCTGGGGCGGCGGGGGCGGCGGG - Intronic
973820552 4:54658401-54658423 GCGCGGGGGGCGGAGGCGGGGGG + Intronic
973981879 4:56314522-56314544 GCTGGAGGAGCGGAGGCGGCAGG + Exonic
975139078 4:70902241-70902263 GCTCGTGAGGTGGGGGCGGCGGG + Intergenic
975719992 4:77240177-77240199 GACCGAGGGGCTAGGGAGGCAGG - Intronic
976194933 4:82523218-82523240 GCCAGAGGGATGGGGGCGGGGGG + Intronic
976390017 4:84497706-84497728 GCCCGGGCGGCGGCGGCGGCGGG + Exonic
976475257 4:85475623-85475645 GCGCCAGGGGAGGGGGCTGCGGG + Intronic
976906278 4:90240273-90240295 GCCAGAGGGGAGGGGGCTTCAGG + Intronic
978777352 4:112516715-112516737 GCCCGAGCGCTGGGGGCGGATGG + Intergenic
981128406 4:141132627-141132649 GACCCCGGGGCCGGGGCGGCGGG - Exonic
981223122 4:142260059-142260081 ACCCGAGGGGCGGAGGTTGCAGG - Intronic
981510942 4:145557655-145557677 TCCCCAGGGGCGGGGGGGTCAGG + Intronic
982198492 4:152937631-152937653 GCCTGCGGGGCGGGGACTGCGGG - Intronic
983904261 4:173168605-173168627 GCCAGAGGGGAGGGGGCCACGGG + Intergenic
985660859 5:1155918-1155940 GCCGGCGGGGCGGGCGCGGGAGG + Intergenic
985888862 5:2700420-2700442 GCCCGAAGGGCGGTGGCCACAGG - Intergenic
985972881 5:3392139-3392161 GCCAGAGAGGCTGGGGAGGCTGG + Intergenic
985995645 5:3595715-3595737 GCGGGAGGGGCGGGAGCGGCCGG + Intergenic
986152483 5:5140274-5140296 GCCGCGGCGGCGGGGGCGGCGGG - Intergenic
986733226 5:10649939-10649961 GCCCGAGCGGCCGGCGCGGAAGG + Exonic
988201788 5:28077913-28077935 GCCCGGCTGGCGGGGCCGGCTGG + Intergenic
988547663 5:32173794-32173816 CCGCGAGGTGCGGGCGCGGCGGG - Exonic
989812396 5:45695169-45695191 TCCCCAGGGGCGAGCGCGGCAGG + Intronic
991214977 5:64150341-64150363 GGCAGAGGGGCGGTGGGGGCCGG - Intergenic
992939512 5:81750032-81750054 GCGGGAGGGGCGGGCCCGGCGGG - Intronic
992939517 5:81750041-81750063 CCCCGAGCGGCGGGAGGGGCGGG - Intronic
995032309 5:107494344-107494366 GCCCGGGCGGCAGGGCCGGCCGG - Intronic
995462504 5:112419089-112419111 GCTTGAGTGGAGGGGGCGGCTGG - Exonic
995744464 5:115389604-115389626 CCCCGAGGGGTGGGGGCAGCTGG + Intergenic
996379022 5:122845461-122845483 GCCCAGGGCGCGGGAGCGGCCGG + Exonic
997585218 5:135039788-135039810 GGGCGACGGGCGGCGGCGGCGGG - Intronic
997675191 5:135707512-135707534 GACCCAAGGGCGGGGGCGGCGGG - Intergenic
998038201 5:138934101-138934123 CCCCGAGGGGTGGGGGCGGCCGG - Exonic
999129450 5:149271807-149271829 GCGGGCGGGGCGGGGGCTGCCGG + Intergenic
999330278 5:150669204-150669226 GCCCGAGGGGGGGTGGGGGGCGG + Intronic
999753368 5:154646835-154646857 TCCCGAGGAGCGACGGCGGCGGG - Intergenic
999956582 5:156709821-156709843 GTCGGGGGGGAGGGGGCGGCAGG - Intronic
1000347957 5:160330439-160330461 GCCCATGGTGCGGAGGCGGCAGG - Intronic
1001382131 5:171311865-171311887 GCCCGGGGGGTGCGGGCGGGGGG - Exonic
1001401936 5:171451068-171451090 GCCCGCGGGCGGGAGGCGGCCGG - Intronic
1001586003 5:172834308-172834330 GCCGGCGGGGGCGGGGCGGCCGG + Exonic
1001643060 5:173258967-173258989 GTCCGTGGGGCGGGGGTAGCAGG - Intergenic
1001933712 5:175690196-175690218 TCCCGAGTGGCGGGGCCAGCTGG - Intergenic
1002103323 5:176868110-176868132 GCCCTGGGGGCGGGAGGGGCAGG - Exonic
1002211158 5:177600147-177600169 GCCCGGGAGGCCGGGCCGGCCGG + Exonic
1002296256 5:178232832-178232854 GCCTGCGGGGCGGGGCCTGCGGG - Intergenic
1002926966 6:1610395-1610417 GAGCGAGGGTGGGGGGCGGCGGG + Exonic
1003566870 6:7229722-7229744 GCTTCAGGGGCGGTGGCGGCAGG - Exonic
1003871180 6:10404468-10404490 GGCCGCGGGGCGGGGCGGGCGGG + Intronic
1003897023 6:10617278-10617300 CCCCGGGCGGCGGGGCCGGCCGG + Intronic
1004114138 6:12749879-12749901 GCCCGACTGCGGGGGGCGGCGGG - Intronic
1004194119 6:13488366-13488388 GGCCTAGGGGCGGGGGAGGTGGG - Intergenic
1004720562 6:18264604-18264626 GGGCGCGGGGCGGGGGAGGCGGG + Exonic
1004861012 6:19804795-19804817 GCCAGCGGAGCGGGGGAGGCGGG + Intergenic
1005470264 6:26156406-26156428 GCCGGAGCAGCGGGCGCGGCAGG - Exonic
1005883044 6:30074812-30074834 GGCGGAGGGGAGGGAGCGGCGGG - Intronic
1005987767 6:30884786-30884808 GGGCGAGGGGCGGGGGAGGCAGG + Intronic
1006170117 6:32087606-32087628 GGCGGTGGGGCGGGGGTGGCGGG + Intronic
1006335838 6:33420239-33420261 GCCTGGGGGGAGGGGGCGGGGGG - Exonic
1006336982 6:33425969-33425991 GCTGGCGGGGCGGGGGCGTCGGG + Intronic
1006851629 6:37102768-37102790 GGGCGAGGGGCCGGGGCGGCCGG - Intergenic
1006860651 6:37169974-37169996 GCGCGCGGGGCGGGGGCCGAGGG + Intergenic
1006860696 6:37170101-37170123 GCGCGCGGGGAGGGCGCGGCGGG - Intergenic
1007444514 6:41895023-41895045 GCGCCCGGGGCGGGGGCGGCGGG - Intronic
1007465552 6:42048865-42048887 CCGCGTGGGGCGGGGGCTGCGGG - Intronic
1007597401 6:43059969-43059991 GTGAGATGGGCGGGGGCGGCAGG - Exonic
1007614275 6:43171365-43171387 CCCCGGGGGGCAGGGGCTGCTGG - Exonic
1007749463 6:44063137-44063159 GCCAGAGGGGTGGGGGCGGCAGG + Intergenic
1010428167 6:75749152-75749174 CCCGAAGGGGCGGGGGCGCCGGG - Intergenic
1010703128 6:79077105-79077127 GCGCGAGAGTCGGCGGCGGCGGG - Intronic
1011517064 6:88166318-88166340 GCGCGAGCGGAGGGAGCGGCAGG - Exonic
1012401410 6:98845237-98845259 GCCCGCGGGGCGGGGCGGGACGG - Intergenic
1014137743 6:117907923-117907945 GCGCGGGGGGCGGGGGCTGCGGG + Intronic
1014632411 6:123803459-123803481 GCCCCCTGGGAGGGGGCGGCAGG + Intergenic
1014798302 6:125749573-125749595 GCTCGAGGGGGGGGCGTGGCCGG + Exonic
1015149107 6:130019310-130019332 GCGGGGGGCGCGGGGGCGGCCGG + Intronic
1015315014 6:131807934-131807956 CCGCGAGGGGCGGGCGCGGCGGG + Intergenic
1015776772 6:136822639-136822661 CAGCGAGGGCCGGGGGCGGCGGG + Exonic
1015826186 6:137314432-137314454 GGGGGAGGGGCGGGGGCGGCAGG - Intergenic
1017696693 6:157022170-157022192 GGTGGAGGGGCGGGGCCGGCGGG + Intronic
1017751237 6:157492194-157492216 GGCTGGGGGGCGGGGGCGGAGGG - Intronic
1017872873 6:158501985-158502007 GCCCCTGCGGCGGGGGAGGCAGG - Exonic
1018017818 6:159727620-159727642 GCCCGGGGGGCCCGGGCGGCAGG + Intronic
1018613054 6:165662157-165662179 GCCGGGGCGGCGGCGGCGGCCGG + Intronic
1018686528 6:166308096-166308118 GCCCCCGGGGCGGGGGCGGGCGG + Exonic
1018921741 6:168180185-168180207 GGCCGAGAGGCAGGGACGGCAGG + Intergenic
1019196575 6:170286750-170286772 GCCGGGGGCGCGGGGGAGGCCGG - Intronic
1019325491 7:436361-436383 GGCCAAGGGGCGGGGGCGGCAGG + Intergenic
1019419709 7:945389-945411 CCCCGAGTGGAGGGGGCAGCTGG - Intronic
1019421904 7:954559-954581 GGCGCAGGGGCGGCGGCGGCGGG - Intronic
1019531302 7:1504699-1504721 TCCCGGAGAGCGGGGGCGGCCGG + Intergenic
1019552650 7:1610757-1610779 GCCTGGGGGGTGGGGGCAGCGGG + Intergenic
1019562565 7:1665874-1665896 GAGCGCGGGGCGGCGGCGGCGGG - Intergenic
1019610350 7:1933582-1933604 GCCAGAGGCCTGGGGGCGGCCGG - Intronic
1019695764 7:2445361-2445383 CCCTGGGGGGCGGGGTCGGCTGG - Intergenic
1019828355 7:3301684-3301706 CAGCGAGGGGCGGGCGCGGCCGG - Exonic
1019975365 7:4577010-4577032 GGCCGAGGGGGGGGGGGGGGTGG - Intergenic
1020130497 7:5556331-5556353 GGCCGCGGGCCGGGGGCGGGAGG - Intronic
1020263614 7:6545837-6545859 GTGCGTGGGGAGGGGGCGGCTGG - Intronic
1020278232 7:6637291-6637313 GCGGGCGGGGCGGGGCCGGCCGG + Intergenic
1021716854 7:23469313-23469335 GGCAGGTGGGCGGGGGCGGCTGG - Intronic
1022068545 7:26886664-26886686 GCCTGGGGGCCGGGGGTGGCGGG - Intronic
1022714975 7:32891349-32891371 GGGGGAGGGGCGCGGGCGGCCGG - Intronic
1022715143 7:32891875-32891897 GCGGGGGCGGCGGGGGCGGCGGG - Exonic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1023972287 7:45000230-45000252 GCCGGGAGCGCGGGGGCGGCGGG + Intronic
1025829808 7:65038759-65038781 GGCCGCGGGGCGGAGGTGGCGGG + Intergenic
1025917063 7:65873759-65873781 GGCCGCGGGGCGGAGGTGGCGGG + Intronic
1026765056 7:73155089-73155111 GCGCGGGGGGCGGCGGCGGCCGG - Intergenic
1026776744 7:73235367-73235389 GCCCTAGGGGCGGAGTCAGCGGG + Intergenic
1026867158 7:73830939-73830961 GGCAGAGGGGCGGGGGCAGAGGG - Exonic
1027001607 7:74658096-74658118 GCCCCCGAGGCGGGGGCGGGGGG - Intronic
1027041529 7:74964844-74964866 GCGCGGGGGGCGGCGGCGGCCGG - Exonic
1027070428 7:75157195-75157217 GCCCTAGGGGCGGAGTCAGCGGG - Intergenic
1027082113 7:75237525-75237547 GCGCGGGGGGCGGCGGCGGCCGG + Intergenic
1029123214 7:98281767-98281789 GCCGGAGCGGCGGGCGCGGCCGG + Exonic
1029390694 7:100272071-100272093 GCGCGGGGGGCGGCGGCGGCCGG + Exonic
1029432335 7:100539375-100539397 GCCCGGGCGGCGGGGTCAGCGGG + Exonic
1029537097 7:101163307-101163329 GGGCGGGGGGCGGGGGCTGCGGG + Exonic
1029640188 7:101815713-101815735 TCCCGAGGGGCGGGGGTCGCCGG + Intergenic
1029708273 7:102286694-102286716 GCCCGAGCGGCGCCGGTGGCCGG - Intronic
1030055841 7:105583161-105583183 GCGCTGAGGGCGGGGGCGGCGGG + Intronic
1030082008 7:105786321-105786343 GCCCCAGGGTTGGGGGAGGCAGG + Intronic
1030138770 7:106284747-106284769 GGCAGGGGGGCGGGGGCGGCTGG - Intronic
1031886930 7:127253143-127253165 CCCCGAGGGGCGGGAGCCTCTGG + Exonic
1032054362 7:128672639-128672661 GCCCTGGGGGAGGGGGGGGCGGG + Intronic
1032091858 7:128915247-128915269 GCGGGAGGGGTGGGGGCGGAGGG - Intergenic
1032096069 7:128939031-128939053 GCGGGAGGGGTGGGGGCGGAGGG + Intronic
1032174410 7:129611924-129611946 GGCCCAGAGCCGGGGGCGGCAGG - Intronic
1032298932 7:130668815-130668837 TCCCGGGGGCCGAGGGCGGCCGG - Exonic
1033220497 7:139523960-139523982 CGGCGAGGGGCGGCGGCGGCCGG - Exonic
1033263812 7:139867318-139867340 GACCGAGCGGAGGGGCCGGCTGG + Intronic
1033477187 7:141702177-141702199 GCGCGAGGGGCGGGGCGGGCGGG + Intergenic
1033644272 7:143288602-143288624 CTCCGAGGGGAGGGGGCTGCAGG - Intronic
1034116628 7:148589519-148589541 GCCAGAGGGGCTGGTGGGGCTGG - Intergenic
1034268584 7:149792666-149792688 GCCGGAGGGGCGGGGGTTGTTGG - Intergenic
1034441043 7:151086323-151086345 GAGCGAGGGGCGGGGGCGCCCGG + Intronic
1034441059 7:151086354-151086376 GCAGGAGGGGCGGGGGCGGCGGG + Intronic
1034446220 7:151115507-151115529 GGCGGCGGTGCGGGGGCGGCCGG - Intronic
1034556892 7:151855744-151855766 GGCAGAGGGGTGGGGGCGGCAGG + Intronic
1034967077 7:155398245-155398267 GGGCGGGGGGCGGGGGGGGCGGG + Intergenic
1034977713 7:155457894-155457916 GGCCGGGCGGCGGCGGCGGCCGG + Intergenic
1035167345 7:156999792-156999814 GCCCGCGGGCCGGGGCGGGCCGG - Intronic
1035171867 7:157021561-157021583 GCCCGAGGGAAGAGGGCAGCTGG + Intergenic
1035264692 7:157684597-157684619 GCCGGAGGGAGGGGGGCGGAGGG - Intronic
1035533945 8:376970-376992 GTCCGGAGGGCGGGGGCTGCGGG + Intergenic
1036638052 8:10564944-10564966 GCCGGTGGGGCGGTGGCGGATGG + Intergenic
1036733302 8:11284771-11284793 GCCCGTGGGGCGGGGCGGGCCGG - Exonic
1037262799 8:17027218-17027240 AACGGAGGGGCGGGGGCGGGGGG - Exonic
1037769545 8:21790233-21790255 GCGCGAGGGCCGGGGGATGCCGG - Intronic
1037896611 8:22660603-22660625 TCCCGTGGGGCAGGGGCGGGGGG + Intronic
1038176373 8:25184830-25184852 GAGCGCGGGGCGGCGGCGGCCGG + Intronic
1038584744 8:28778569-28778591 GTCTGAGGGGCTGGGGCTGCTGG - Intronic
1038632939 8:29262936-29262958 GCCGCCGGGGCGGAGGCGGCAGG - Intronic
1038725967 8:30082918-30082940 GCCTGCGGGCCGGGAGCGGCCGG - Exonic
1039415858 8:37393663-37393685 GGCCCAGGGGCGGGGTGGGCGGG - Intergenic
1040038981 8:42897258-42897280 GCCCGTGGGGCGAGCGCTGCGGG + Intronic
1040079101 8:43269860-43269882 TCCCGAGTGGCTGGGGCTGCAGG - Intergenic
1040677216 8:49765214-49765236 GCTAGCGGGGCAGGGGCGGCGGG - Intergenic
1040915882 8:52565731-52565753 GCTCGGGGGGTGGAGGCGGCGGG - Intergenic
1041068060 8:54101578-54101600 CCGCGGGGGGCGGGGGCAGCCGG - Intronic
1041377104 8:57216014-57216036 GGTGGAGGGGCGGGGGCCGCAGG + Intergenic
1041690039 8:60679213-60679235 GGGCGAGGGGCGAGGGCGGGAGG + Intronic
1041690154 8:60679659-60679681 GAGCGGGGGGCGGGGGCGGGAGG - Intronic
1042040219 8:64581386-64581408 GCCTGGGCGGCGGCGGCGGCGGG + Exonic
1042246477 8:66713046-66713068 GCCCAAGGGGCGTCGGTGGCTGG + Intronic
1043472106 8:80573345-80573367 CTCCGAGGGGCGGGGACGGCTGG - Intergenic
1043854172 8:85245712-85245734 GACCGCGGGGCGCCGGCGGCAGG - Exonic
1044306532 8:90646143-90646165 GCCAGAGGGGGCGGGGCCGCGGG + Intronic
1045063765 8:98427947-98427969 CCCCGCGCGGCGCGGGCGGCCGG + Exonic
1045367966 8:101493722-101493744 GGCCGAGGGCTCGGGGCGGCGGG + Intronic
1045488538 8:102653888-102653910 AGACGAGGGGCGGGGGCGGACGG + Intronic
1045516496 8:102864477-102864499 GCCCGAGAGGCGGCGGGGGTCGG - Exonic
1046547432 8:115669110-115669132 TCCCGGCGGGCGGCGGCGGCGGG - Intronic
1046871306 8:119208410-119208432 GCCCGGGAGGCGGAGGCGGGAGG + Exonic
1047225867 8:122955067-122955089 GCCGGGGGGGGGGGGGTGGCAGG + Intronic
1047753004 8:127896779-127896801 GCCTGTGGGTCGGGGGCGGGGGG - Intergenic
1047961252 8:130013674-130013696 GCCCGAGGGACGCGGGTGCCAGG - Intronic
1048049364 8:130802887-130802909 GCCCAAGGGGCGAGGGAGCCGGG - Intronic
1048152155 8:131904333-131904355 GGCCGAGGGCCGGGGGCGTTGGG + Intronic
1048553981 8:135457626-135457648 GCCCGGAGCGCGGGGGCCGCCGG + Exonic
1048633606 8:136271540-136271562 GGCGGGGGGGGGGGGGCGGCAGG - Intergenic
1049109666 8:140635308-140635330 GCTCGAGGAGCGGCGGCGGCGGG - Intronic
1049109691 8:140635366-140635388 GGCCGCGGGGTCGGGGCGGCGGG - Intronic
1049109813 8:140635685-140635707 GCGGGAGGGGCGGGGGAGGAAGG + Intergenic
1049194516 8:141308108-141308130 GCCGGGGCCGCGGGGGCGGCGGG + Intronic
1049288583 8:141789949-141789971 GCCAGCGGGGCGGCAGCGGCAGG - Intergenic
1049290221 8:141797811-141797833 GCCCTGGGGGCTTGGGCGGCAGG + Intergenic
1049372595 8:142274904-142274926 GTCCTCAGGGCGGGGGCGGCTGG - Intronic
1049532253 8:143160365-143160387 GCGCGGGGGGCGGGGGCGGCTGG + Intronic
1049580364 8:143408080-143408102 GCCGGAGGGGCGGAGCCGGAAGG - Intergenic
1049601170 8:143508321-143508343 GCCAGAGGGGCGGGGCTGGGAGG + Intronic
1049620656 8:143597109-143597131 GTCCGCGGGACGGGGGCGCCGGG - Intronic
1049620704 8:143597279-143597301 GCCCGAGGGGCCGGGAGGGCGGG - Intronic
1049624638 8:143614553-143614575 CCCCCAGGGGCGGGTGGGGCCGG - Intronic
1049714364 8:144082897-144082919 GCCGGAGGGGCGCGAGCAGCTGG - Intronic
1049746898 8:144266786-144266808 GCCGGCGGGCCGGGGGCGGGGGG + Exonic
1049760692 8:144330808-144330830 GCCCGAGGTGCGGGGGCCCTCGG - Exonic
1049803447 8:144528643-144528665 GCTCGAGGGGCGGGGCCGGAGGG - Intronic
1049884383 9:17679-17701 GGCCGAGGGGTGTGGGCGGGAGG - Intergenic
1051416590 9:16847399-16847421 GGCGGGGGGGGGGGGGCGGCGGG + Intronic
1052991765 9:34522851-34522873 GCCTGCGGGCGGGGGGCGGCGGG + Exonic
1053157562 9:35791559-35791581 GGGGGAGGGGCGGGGGCGGGCGG + Intergenic
1053306264 9:36986614-36986636 TCCCCAGGGCCGGGGGCGGAGGG - Intronic
1053460827 9:38269885-38269907 GCCCAAGGGGCAGGGGAGACAGG + Intergenic
1053786347 9:41655249-41655271 GGCCGGGAGGCGGGGGCGGGAGG + Intergenic
1053835349 9:42129350-42129372 GCCCCAGGCACGGAGGCGGCAGG + Exonic
1054091018 9:60847313-60847335 GCCCCAGGCACGGAGGCGGCAGG + Intergenic
1054112429 9:61122869-61122891 GCCCCAGGCACGGAGGCGGCAGG + Intergenic
1054595276 9:67059260-67059282 GCCCCAGGCACGGAGGCGGCAGG - Intergenic
1054731435 9:68705625-68705647 GCGGGAGGGGCGGGAGGGGCGGG - Intronic
1055638011 9:78296862-78296884 GCCCGAGGATTGTGGGCGGCGGG - Intergenic
1055645073 9:78355593-78355615 GTGCAAGGGCCGGGGGCGGCGGG + Intergenic
1055814130 9:80185377-80185399 GGGCAAGGGGCGGGGGCGGGGGG + Intergenic
1056163551 9:83921275-83921297 GCGGGAGCGGCGGGCGCGGCGGG + Intronic
1056406754 9:86282468-86282490 GCCCGAGGCACCGGGGCGCCGGG - Exonic
1057054122 9:91948876-91948898 GCCCGAGGCGCGCGGGCGGGAGG + Intronic
1057238864 9:93391145-93391167 GCCCGAGGGGAGTGGGTGGACGG + Intergenic
1057259666 9:93576673-93576695 GCGGGGGCGGCGGGGGCGGCGGG - Exonic
1057801265 9:98192672-98192694 GCCCGGCGGGCGGGGCCGGAGGG + Intergenic
1058236836 9:102500416-102500438 GGCCGAGGGGTGGGGGGGGGGGG + Intergenic
1059061388 9:111038236-111038258 GGCGGTGGGGCGGGGGCCGCCGG - Intronic
1059123266 9:111661505-111661527 GCCGGGTGGGCTGGGGCGGCGGG + Exonic
1059375255 9:113876229-113876251 GCCGGGGGGGCGGGGGCGCTGGG - Intergenic
1059950887 9:119461449-119461471 GCCCGAGGGGAGGCAGTGGCAGG - Intergenic
1060106782 9:120877439-120877461 GCCCGCGGGGCGGGCGGGGGCGG - Intronic
1060544092 9:124450371-124450393 GGCCGAGGGGCGGGGTCTCCCGG + Intergenic
1060629495 9:125143261-125143283 ACCGGAGGGGCGGGGGGTGCAGG - Intronic
1060695737 9:125707312-125707334 TCCCGCGGGGCGGGGCCGGGAGG + Intergenic
1060856035 9:126915268-126915290 GCGCGGGGGGCGGGGCCGGGGGG + Intronic
1060856056 9:126915319-126915341 GTGCGGGGGGCGGGGCCGGCGGG + Intronic
1060945825 9:127568984-127569006 GCGGGAGCGGCGGGAGCGGCGGG - Exonic
1060991949 9:127854450-127854472 ACCCGAGGGGAGCAGGCGGCCGG + Exonic
1061050351 9:128191485-128191507 GGCCGAGGCGTGGGGGCTGCGGG - Exonic
1061275792 9:129568902-129568924 GCCTGGGGGGCGGCGGGGGCGGG - Intergenic
1061321829 9:129835642-129835664 GGGAGAGGGGCGGCGGCGGCCGG - Intronic
1061373935 9:130213114-130213136 GCCGGAGGGGCAGGTGAGGCGGG + Intronic
1061450348 9:130664119-130664141 GCGCGAGGGGCGGGGGCGCGCGG - Intergenic
1061502214 9:131010408-131010430 CCCCGTGGGGCGGGAGAGGCAGG + Intronic
1061559779 9:131394613-131394635 GCCGGAGGGGCGGGGGTCCCGGG + Intronic
1061609945 9:131739719-131739741 GCCCCAGGGCCGGGCCCGGCCGG + Intronic
1061773442 9:132944926-132944948 GCCCGAGGGGGCGGGGCGGGCGG + Intergenic
1061899211 9:133664398-133664420 TCCCTCGGGGCAGGGGCGGCTGG + Intronic
1062033816 9:134373916-134373938 ACCCGAGAGGCCGGGGCGGGAGG - Intronic
1062412730 9:136433123-136433145 GCTGGAGGGGTGGGCGCGGCTGG - Intronic
1062428103 9:136515345-136515367 GCCCGAGTCGCAGGGGCTGCTGG + Exonic
1062444283 9:136587221-136587243 GCCCGTGGGGAGGGGGGTGCGGG - Intergenic
1062472415 9:136712362-136712384 GCATGAGGGGCGGGGTCTGCGGG + Intergenic
1062533507 9:137011749-137011771 GCTGCAGGGGTGGGGGCGGCTGG + Exonic
1062617259 9:137403460-137403482 CTCCGAGGGTCGGGGGCCGCAGG + Intronic
1203518443 Un_GL000213v1:25608-25630 ACCCTAGGTGCGGGGGAGGCGGG - Intergenic
1185462352 X:339262-339284 GCCCCATGGCCGGGGGGGGCAGG + Intronic
1186357398 X:8801676-8801698 GCCAAAGGGGCAGGGGTGGCTGG - Intergenic
1186378730 X:9034375-9034397 GCCAAAGGGGCAGGGGTGGCTGG - Intronic
1186802802 X:13110598-13110620 GGCGGAGGGGCGGGGGTGGGGGG - Intergenic
1187173149 X:16870584-16870606 GCCCGAGGGGGCGGGGCGGATGG + Intergenic
1187281437 X:17860926-17860948 GCCCGGAGGCCGGGGCCGGCTGG - Intronic
1187516545 X:19976465-19976487 ACCCGAGAGGCGGAGGCTGCAGG - Intergenic
1189323274 X:40098460-40098482 GCCGAAGGGATGGGGGCGGCGGG + Intronic
1189331365 X:40146688-40146710 GCCACGGGGGCGGGCGCGGCGGG - Intronic
1189698677 X:43693740-43693762 GCCACAGGGGTGGGGGTGGCAGG + Intronic
1190914344 X:54799252-54799274 GCCGGAGGGCCAGGGTCGGCAGG - Intergenic
1191059093 X:56276134-56276156 GGGCGAGGTGCGGGGGCGGGGGG - Intronic
1191836689 X:65470568-65470590 GCCCCAAGGGTGAGGGCGGCAGG - Intronic
1191955525 X:66639116-66639138 GTCTGAGGGGCGGGGGCTGAGGG - Intronic
1191955542 X:66639156-66639178 GGCTGAGGGGCGGGGGCTGAGGG - Intronic
1192251421 X:69417009-69417031 TGCTGGGGGGCGGGGGCGGCAGG - Intergenic
1195113027 X:101666154-101666176 GGCGGTGGGGCGGGGGCGGGGGG + Intergenic
1196424980 X:115561120-115561142 GGCCGAGGGGCGGAGGGGGCTGG + Intergenic
1196965157 X:121047540-121047562 GCCCAAGGGGAGGGGACAGCCGG + Intergenic
1197754299 X:129983693-129983715 GCTCTAGGGGCGGGGGCCGCCGG + Intronic
1197758767 X:130013811-130013833 GACGGAGGGGCAGGGGCCGCTGG - Exonic
1197766076 X:130060287-130060309 GCGCGAGGGGAGGGGAGGGCAGG + Intergenic
1197782444 X:130171686-130171708 GGCCGAGGCGCGGCGGCGGCTGG + Exonic
1197871836 X:131068670-131068692 GCTCGGGGGGTGGGGGCGGGTGG - Intronic
1198388139 X:136147717-136147739 CCCCGAGCGGCGGCGGCGGCGGG - Intronic
1198398840 X:136250958-136250980 ACGGGCGGGGCGGGGGCGGCTGG - Intronic
1199832980 X:151562862-151562884 GGGCGGGGGGCGGGGGGGGCGGG + Intergenic
1200098171 X:153673829-153673851 GCCGGCGGGGCGCGGGCGGGGGG - Intronic
1200133032 X:153861904-153861926 TCCTGGGGGGTGGGGGCGGCTGG + Exonic
1200233619 X:154458211-154458233 CCGCGCGGGGCGGGGGCGTCCGG - Intergenic
1200310280 X:155071166-155071188 GGCCGGGCGGCGGGGGCGGCAGG - Exonic
1200401422 X:156022477-156022499 GGCCGAGGGGTGTGGGCGGGAGG + Intergenic