ID: 1134545641

View in Genome Browser
Species Human (GRCh38)
Location 16:15105912-15105934
Sequence GATGGGGGCCCCACTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134545629_1134545641 23 Left 1134545629 16:15105866-15105888 CCCATTTGTTATTACAAATACGG No data
Right 1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG No data
1134545631_1134545641 22 Left 1134545631 16:15105867-15105889 CCATTTGTTATTACAAATACGGA No data
Right 1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG No data
1134545632_1134545641 -2 Left 1134545632 16:15105891-15105913 CCTCTGACACTTAGAATATTAGA No data
Right 1134545641 16:15105912-15105934 GATGGGGGCCCCACTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134545641 Original CRISPR GATGGGGGCCCCACTGGGTG GGG Intronic
No off target data available for this crispr