ID: 1134548351

View in Genome Browser
Species Human (GRCh38)
Location 16:15127342-15127364
Sequence CACCAAAGGCTGCTCGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134548351_1134548363 16 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548363 16:15127381-15127403 GCTGCAGCACTGGAAAGTGGCGG No data
1134548351_1134548357 -6 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548357 16:15127359-15127381 TTGGTGGACGCCTTTCCCTCTGG No data
1134548351_1134548366 28 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259
1134548351_1134548364 22 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG 0: 1
1: 5
2: 1
3: 11
4: 120
1134548351_1134548365 23 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137
1134548351_1134548362 13 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548362 16:15127378-15127400 CTGGCTGCAGCACTGGAAAGTGG No data
1134548351_1134548359 6 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548359 16:15127371-15127393 TTTCCCTCTGGCTGCAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134548351 Original CRISPR CACCAAAGGCTGCTCGGGAA GGG (reversed) Intronic
No off target data available for this crispr