ID: 1134548357

View in Genome Browser
Species Human (GRCh38)
Location 16:15127359-15127381
Sequence TTGGTGGACGCCTTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134548351_1134548357 -6 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548357 16:15127359-15127381 TTGGTGGACGCCTTTCCCTCTGG No data
1134548352_1134548357 -7 Left 1134548352 16:15127343-15127365 CCTTCCCGAGCAGCCTTTGGTGG No data
Right 1134548357 16:15127359-15127381 TTGGTGGACGCCTTTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134548357 Original CRISPR TTGGTGGACGCCTTTCCCTC TGG Intronic
No off target data available for this crispr