ID: 1134548362

View in Genome Browser
Species Human (GRCh38)
Location 16:15127378-15127400
Sequence CTGGCTGCAGCACTGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134548356_1134548362 -1 Left 1134548356 16:15127356-15127378 CCTTTGGTGGACGCCTTTCCCTC No data
Right 1134548362 16:15127378-15127400 CTGGCTGCAGCACTGGAAAGTGG No data
1134548354_1134548362 8 Left 1134548354 16:15127347-15127369 CCCGAGCAGCCTTTGGTGGACGC No data
Right 1134548362 16:15127378-15127400 CTGGCTGCAGCACTGGAAAGTGG No data
1134548351_1134548362 13 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548362 16:15127378-15127400 CTGGCTGCAGCACTGGAAAGTGG No data
1134548355_1134548362 7 Left 1134548355 16:15127348-15127370 CCGAGCAGCCTTTGGTGGACGCC No data
Right 1134548362 16:15127378-15127400 CTGGCTGCAGCACTGGAAAGTGG No data
1134548352_1134548362 12 Left 1134548352 16:15127343-15127365 CCTTCCCGAGCAGCCTTTGGTGG No data
Right 1134548362 16:15127378-15127400 CTGGCTGCAGCACTGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134548362 Original CRISPR CTGGCTGCAGCACTGGAAAG TGG Intronic
No off target data available for this crispr