ID: 1134548364

View in Genome Browser
Species Human (GRCh38)
Location 16:15127387-15127409
Sequence GCACTGGAAAGTGGCGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 5, 2: 1, 3: 11, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134548360_1134548364 -10 Left 1134548360 16:15127374-15127396 CCCTCTGGCTGCAGCACTGGAAA No data
Right 1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG 0: 1
1: 5
2: 1
3: 11
4: 120
1134548358_1134548364 -5 Left 1134548358 16:15127369-15127391 CCTTTCCCTCTGGCTGCAGCACT No data
Right 1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG 0: 1
1: 5
2: 1
3: 11
4: 120
1134548354_1134548364 17 Left 1134548354 16:15127347-15127369 CCCGAGCAGCCTTTGGTGGACGC No data
Right 1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG 0: 1
1: 5
2: 1
3: 11
4: 120
1134548351_1134548364 22 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG 0: 1
1: 5
2: 1
3: 11
4: 120
1134548352_1134548364 21 Left 1134548352 16:15127343-15127365 CCTTCCCGAGCAGCCTTTGGTGG No data
Right 1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG 0: 1
1: 5
2: 1
3: 11
4: 120
1134548355_1134548364 16 Left 1134548355 16:15127348-15127370 CCGAGCAGCCTTTGGTGGACGCC No data
Right 1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG 0: 1
1: 5
2: 1
3: 11
4: 120
1134548356_1134548364 8 Left 1134548356 16:15127356-15127378 CCTTTGGTGGACGCCTTTCCCTC No data
Right 1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG 0: 1
1: 5
2: 1
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134548364 Original CRISPR GCACTGGAAAGTGGCGGCTC TGG Intronic
901749627 1:11397772-11397794 ACACTGGAAAGTGCAGGCCCTGG - Intergenic
902801308 1:18831892-18831914 GCACTGGCCAGTGGTGGCTGTGG - Intergenic
902815343 1:18913333-18913355 CCACTGGACCCTGGCGGCTCCGG - Intronic
906492294 1:46278164-46278186 GCACTGATAAGTGGGGGCTCCGG + Exonic
907390202 1:54153092-54153114 TCACTGTAAAGTGACGGATCTGG + Exonic
911520264 1:98921371-98921393 GCACTGGGACATGGAGGCTCAGG + Intronic
912700707 1:111876389-111876411 GCACTGCAAGGTGGCTGTTCTGG + Intronic
912771791 1:112470893-112470915 GGTCTGGAAAGTGTCTGCTCTGG + Intronic
913249555 1:116901187-116901209 GCACAGGAAAGGGGCAGGTCTGG + Intergenic
913661502 1:121009649-121009671 GCACAGGAAAGTGTCGCTTCAGG - Intergenic
914012870 1:143792829-143792851 GCACAGGAAAGTGTCGCTTCAGG - Intergenic
914164959 1:145168356-145168378 GCACAGGAAAGTGTCGCTTCAGG + Intergenic
914651495 1:149701438-149701460 GCACAGGAAAGTGTCGCTTCAGG - Intergenic
915091643 1:153430274-153430296 GCACTGGACAGTGGCTCCTGCGG - Intergenic
920555552 1:206901666-206901688 GCTCTGGATACTGGCAGCTCTGG + Intronic
920706021 1:208251169-208251191 GCAATGCCAAGTGGCGGCCCAGG + Intergenic
922782108 1:228260692-228260714 GAACTGGGAATTGGTGGCTCTGG + Intronic
922851235 1:228735603-228735625 GCCCTGGAGAGTGGCGGTTCCGG - Exonic
1071325485 10:84512134-84512156 GCACTGGACAATGGCTGCCCAGG - Intronic
1071567137 10:86677135-86677157 TCACAGGAAAGAGGAGGCTCCGG - Intronic
1075811623 10:125228473-125228495 GCACAGGAAAGTGACGTCGCGGG + Intergenic
1082810074 11:57474354-57474376 GCACAGGAAGGTGGAGGCTGTGG + Intronic
1082852597 11:57778629-57778651 GCAGGGCAAAGTGGGGGCTCTGG + Intronic
1086147121 11:83564331-83564353 GCACTGGAATGGGGGGGGTCAGG + Intronic
1088735212 11:112723116-112723138 GCAGTGAAATGTGGGGGCTCAGG - Intergenic
1089092225 11:115887592-115887614 GCCATGGAAAGTGGAGGCACAGG - Intergenic
1089167609 11:116489071-116489093 GCACTGACAAGTGGCAGCACGGG - Intergenic
1089697169 11:120223039-120223061 GCCTTCGAATGTGGCGGCTCTGG - Intronic
1089757717 11:120698682-120698704 GCACTGCAAACTGGCAGCACAGG - Intronic
1090856478 11:130613192-130613214 ACACTGAAAAATGGGGGCTCTGG - Intergenic
1095510445 12:42945986-42946008 GCTCTGGAAAGTGGCTGGCCAGG + Intergenic
1099947678 12:89263491-89263513 GAACTGGGAATTGGCTGCTCTGG - Intergenic
1102255214 12:111411013-111411035 GCAGGGGAGAGTGGAGGCTCTGG + Intronic
1102512518 12:113425324-113425346 GGACTGGGAAGAGGTGGCTCAGG + Intronic
1102885834 12:116521142-116521164 GCACAGGAAATGGGCGGCACGGG + Intergenic
1103861900 12:124022099-124022121 ACACTGGAAAGTGGCTGCTCTGG - Intronic
1104775449 12:131387859-131387881 GCACTGCACCGTGGCGGCACCGG - Intergenic
1104862845 12:131933636-131933658 GCACAGGAATGTGGCGTCACAGG - Intronic
1110046840 13:70842243-70842265 GCAGTGGAGAGTGGCAGCTGTGG - Intergenic
1112752511 13:102597100-102597122 GCAGAGGAAGGAGGCGGCTCCGG - Exonic
1113673692 13:112194167-112194189 GAACTGGAAACTGGCTGCTCAGG - Intergenic
1114049680 14:18913011-18913033 GCTCTGGGAAGTGGCAGCCCAGG + Intergenic
1119334989 14:73825772-73825794 GCTCTGGAAAGTGCAGGCTCTGG + Intergenic
1121222845 14:92299428-92299450 GCACAGGGAAGTGGGGGCTCTGG - Intergenic
1122660369 14:103290836-103290858 CCACTGGACAGTGGCTGGTCAGG - Intergenic
1123165320 14:106320209-106320231 GCTCTGGAAAGTGCAGGCCCTGG + Intergenic
1123628010 15:22240830-22240852 ACACTGGGAAATGGAGGCTCAGG + Intergenic
1125489712 15:40137384-40137406 GCAATGCCAAGTGGCGTCTCTGG - Intergenic
1126134606 15:45378279-45378301 GCGAGGGAAGGTGGCGGCTCCGG + Intronic
1128281635 15:66399563-66399585 GTACTGGGAAGTGGAGGCTCTGG - Intronic
1132112694 15:99114072-99114094 GAACTGGAAAGTGGAGGGCCAGG + Intronic
1133228553 16:4355109-4355131 GCACTAGGAAGTGGCAGCACAGG + Exonic
1134247671 16:12552129-12552151 GTACTGGAATGTGGCCTCTCAGG - Intronic
1134467434 16:14491953-14491975 GGACTGGAAACTGGAGGCCCTGG + Intronic
1134524539 16:14933554-14933576 GCACTGGAAAGTGGCGGCCCTGG - Intronic
1134548364 16:15127387-15127409 GCACTGGAAAGTGGCGGCTCTGG + Intronic
1134712128 16:16332041-16332063 GCACTGGAAAGTGGCGGCCCTGG - Intergenic
1134719985 16:16375334-16375356 GCACTGGAAAGTGGCGGCCCTGG - Intergenic
1134947441 16:18336551-18336573 GCACTGGAAAGTGGCGGCCCTGG + Intronic
1134954701 16:18376653-18376675 GCACTGGAAAGTGGCGGCCCTGG + Intergenic
1136630759 16:31488182-31488204 GCACAGGAAAGGGGCGGGGCAGG - Intronic
1137676208 16:50305019-50305041 CCACTGGACAGAGGCTGCTCAGG - Intronic
1141157932 16:81610063-81610085 GAGCAGGAAAGTGGAGGCTCAGG - Intronic
1149510566 17:57237622-57237644 GGACTGGGAAGTGGTGGGTCAGG - Intergenic
1157075483 18:44462070-44462092 GCAGTGGAAGGTGGTGGCTAGGG + Intergenic
1162843378 19:13372545-13372567 CAACTGGAAAGTGGCAGATCTGG - Intronic
1165129481 19:33622811-33622833 GCCCTGGAGAGTTGCGGGTCGGG - Intronic
1166065773 19:40358049-40358071 GCACTGGAGGGTGGTGGCTGGGG - Intronic
1166640817 19:44493812-44493834 GCCCTGGAAAGAGGCCTCTCTGG + Intronic
1167593184 19:50415238-50415260 GCAGTGGAAAGAGTCGGCTTGGG + Intronic
1168103685 19:54154104-54154126 GCACTGCAAAGGGGAGGCACTGG - Intronic
934734710 2:96684085-96684107 CCACTGGAAACTGGGGACTCTGG + Intergenic
937153926 2:119704965-119704987 GGAAGGGAAAGTTGCGGCTCTGG + Intergenic
939766888 2:146261899-146261921 GCACTTGAAAGTGACTGCTATGG + Intergenic
940846758 2:158650686-158650708 GCAGTGGGAAGTGGGTGCTCAGG - Intronic
940954477 2:159712632-159712654 GCACTGGTCGGTGCCGGCTCAGG + Intronic
942279348 2:174344255-174344277 GGACTGGAGAAAGGCGGCTCCGG + Intergenic
948932812 2:241142960-241142982 ACACTGGCAAGGGGAGGCTCTGG + Exonic
1168951603 20:1805598-1805620 GCACTGAAATGTGGCGGTGCTGG - Intergenic
1173718203 20:45229889-45229911 GCCCTGAAAAGTGGCGGGTAGGG + Intergenic
1174573858 20:51523526-51523548 GCACGGGCGAGTGGCGGCCCAGG + Exonic
1175184129 20:57168318-57168340 GCACTGGACAGTGTCAGCTCTGG + Intergenic
1180200649 21:46222117-46222139 GTACTGCAGAGTGGCTGCTCAGG - Intronic
1182762719 22:32735573-32735595 GCCCTGGAATTTGACGGCTCTGG + Intronic
1184171791 22:42764391-42764413 GCACTGGAAGGTGGCGGAGCTGG - Intergenic
1185307113 22:50125324-50125346 ACTCTGGAAAGTAGCAGCTCCGG - Intronic
950329157 3:12142672-12142694 AGACTGGAAAGTGGCGGAGCTGG + Intronic
950906861 3:16546362-16546384 GCACAGAGAAGTGGCTGCTCCGG - Intergenic
955197887 3:56822309-56822331 GGACTGGAAAGTGTGGGCCCTGG - Intronic
955476561 3:59342056-59342078 GCTCTGGCAGGTGGAGGCTCTGG - Intergenic
960512814 3:118571453-118571475 TCTCTGGAAAGTGGCACCTCCGG - Intergenic
965740852 3:171873019-171873041 GAACTGGAAAGTGTGGGCTTGGG + Intronic
970491676 4:16581772-16581794 GAACTGGTAAGTGGCAGTTCAGG - Intronic
971060901 4:22968135-22968157 GCTCTGGAATCTGGCTGCTCGGG + Intergenic
972285603 4:37644940-37644962 CCGCTGGAAAGTGGCGGAGCTGG - Intronic
993088411 5:83393420-83393442 TCACTGCAAAGTGGCAGCACAGG + Intergenic
997518861 5:134509331-134509353 GAACTGGAGAGTGGCGGAGCTGG - Intergenic
999111010 5:149121424-149121446 GCACAGGAAAGTGCATGCTCTGG - Intergenic
999277022 5:150338302-150338324 GTGCTGGAAAGTGTAGGCTCTGG - Intronic
999383963 5:151141187-151141209 GCACTGAAAAGTGGGGGGTCTGG + Intronic
1000220296 5:159208770-159208792 GAGCTGGAAAGGGGCCGCTCTGG + Intronic
1001424916 5:171616609-171616631 GCACTGGAATCTGACAGCTCAGG + Intergenic
1007071267 6:39040063-39040085 GCCCTGGAATGGGGAGGCTCTGG - Intergenic
1007821413 6:44563135-44563157 GCACTGGGATGTCGGGGCTCTGG + Intergenic
1012853150 6:104470697-104470719 GCCATGCAAAGTGGTGGCTCAGG + Intergenic
1017553621 6:155539269-155539291 GCTCTGGAAAGTGGAGGTCCAGG + Intergenic
1017583164 6:155889583-155889605 GCACTGGAAACTGGCAGGGCTGG + Intergenic
1019219226 6:170461746-170461768 GCACGAGAAAGAGGCAGCTCAGG + Intergenic
1019446876 7:1075972-1075994 GCCCTGGAGAGTGGCAGCCCCGG - Intronic
1019813797 7:3184521-3184543 TCACTGGCATGGGGCGGCTCTGG - Intergenic
1019905094 7:4056746-4056768 GCACTGCATAGTAGCTGCTCTGG - Intronic
1020602184 7:10290051-10290073 GAACTTGAATGTGGCAGCTCTGG - Intergenic
1022350484 7:29563315-29563337 GCACGGGAAAATGGTTGCTCAGG - Intergenic
1024118011 7:46211080-46211102 ACACGGGGAAGTGGGGGCTCAGG + Intergenic
1024526539 7:50354324-50354346 GCCCTGGCTAGTGGGGGCTCTGG - Intronic
1024809827 7:53195741-53195763 CCACTGGAAGGTGCAGGCTCCGG + Intergenic
1024818239 7:53295889-53295911 GCACTGGAGAGTGGTGGGTGAGG + Intergenic
1027726271 7:81809982-81810004 GCCCTGGAAACTGGCGGTTGAGG + Intergenic
1028445427 7:90916516-90916538 GCCCTGGACAGTGGCATCTCTGG - Intronic
1029547362 7:101217351-101217373 GCTCTGGAAAGGGGGCGCTCGGG + Exonic
1030005365 7:105112911-105112933 ACACTGGAAGGTGGCGGCGGAGG - Exonic
1035395766 7:158533972-158533994 GCACTGGCCAGTGGAGGCCCAGG - Intronic
1038577498 8:28717487-28717509 GCAGTGGAACGAGGCGGCCCTGG + Exonic
1042224478 8:66504784-66504806 GCACTGGGAAGTGGGGACGCGGG + Intronic
1048257110 8:132913332-132913354 GCACTGGAGAGAGGCTACTCTGG + Intronic
1049196458 8:141318342-141318364 GGCCTGGGAAGTGGCTGCTCAGG - Intergenic
1051569697 9:18541651-18541673 TAACTGGTAAGTGGCAGCTCAGG - Intronic
1053418007 9:37958901-37958923 GCTCTGCAAAGTAGGGGCTCGGG - Intronic
1056332634 9:85534413-85534435 GCACAGGAGAGTGGGGGCGCTGG + Intergenic
1060629401 9:125143006-125143028 GCACAGGAAAGGGGAGGCTAGGG - Intronic
1060878555 9:127101295-127101317 TGACTGGAAAGTGGAGGATCTGG + Intronic
1061725446 9:132579982-132580004 GCCCTGGGGAGGGGCGGCTCCGG + Intergenic
1062364667 9:136203052-136203074 GGACTGGAGAGTGGCGACGCCGG - Exonic
1192583920 X:72305836-72305858 GCGCTAGAAAGTGGCGGAGCCGG + Intronic
1196027271 X:111054295-111054317 GCACTGGAAAGTGGCTTCACTGG - Intronic
1197400779 X:125987582-125987604 GCACTAGAAAGTTGGGGCTAGGG + Intergenic
1198788561 X:140317440-140317462 GCTCAGGAGAGTGGTGGCTCAGG - Intergenic
1198967727 X:142244898-142244920 GCACTGGAAAGTGGGTCCTCAGG - Intergenic