ID: 1134548365

View in Genome Browser
Species Human (GRCh38)
Location 16:15127388-15127410
Sequence CACTGGAAAGTGGCGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 7, 2: 0, 3: 13, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134548358_1134548365 -4 Left 1134548358 16:15127369-15127391 CCTTTCCCTCTGGCTGCAGCACT No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137
1134548356_1134548365 9 Left 1134548356 16:15127356-15127378 CCTTTGGTGGACGCCTTTCCCTC No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137
1134548355_1134548365 17 Left 1134548355 16:15127348-15127370 CCGAGCAGCCTTTGGTGGACGCC No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137
1134548351_1134548365 23 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137
1134548354_1134548365 18 Left 1134548354 16:15127347-15127369 CCCGAGCAGCCTTTGGTGGACGC No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137
1134548361_1134548365 -10 Left 1134548361 16:15127375-15127397 CCTCTGGCTGCAGCACTGGAAAG No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137
1134548352_1134548365 22 Left 1134548352 16:15127343-15127365 CCTTCCCGAGCAGCCTTTGGTGG No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137
1134548360_1134548365 -9 Left 1134548360 16:15127374-15127396 CCCTCTGGCTGCAGCACTGGAAA No data
Right 1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG 0: 1
1: 7
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134548365 Original CRISPR CACTGGAAAGTGGCGGCTCT GGG Intronic
900936925 1:5771928-5771950 CACTAGAAAGTGGCAGAGCTGGG - Intergenic
902117011 1:14129493-14129515 CACTGGAAAGTGGAGGATTCAGG - Intergenic
902815342 1:18913332-18913354 CACTGGACCCTGGCGGCTCCGGG - Intronic
906492295 1:46278165-46278187 CACTGATAAGTGGGGGCTCCGGG + Exonic
908255658 1:62301604-62301626 CACTGGTAAGTGGCAGAGCTGGG - Intronic
909516569 1:76514433-76514455 CACTGGAAAGTGGGGCCTAGTGG + Intronic
912380748 1:109247036-109247058 CACTTCACAGTGGAGGCTCTGGG - Intergenic
913249556 1:116901188-116901210 CACAGGAAAGGGGCAGGTCTGGG + Intergenic
919750326 1:201033930-201033952 AACTGGTAAGTGGCAGATCTGGG - Intergenic
920555553 1:206901667-206901689 CTCTGGATACTGGCAGCTCTGGG + Intronic
921333632 1:214064823-214064845 AACTGGCAAGTGGGTGCTCTTGG - Intergenic
922089126 1:222378793-222378815 GACTGGAAAGTGGCAGGACTGGG - Intergenic
922159382 1:223067439-223067461 CACTGGTAAGTGGCAGACCTTGG - Intergenic
922281287 1:224126890-224126912 GACTTGAAAGTGGTGCCTCTGGG - Intronic
922851233 1:228735602-228735624 CCCTGGAGAGTGGCGGTTCCGGG - Exonic
924321379 1:242854635-242854657 CTCTGGAAAGTGGCACCTCCTGG - Intergenic
1065318065 10:24483875-24483897 CCCTGGGGAGTGGCGGCTCTAGG + Intronic
1068169724 10:53377886-53377908 CTCTGGATAGAGGCAGCTCTGGG - Intergenic
1068962616 10:62880715-62880737 CACTGGCAAGTGGTCCCTCTGGG + Intronic
1069627427 10:69876902-69876924 AAATGCAAAGTGGCAGCTCTGGG + Intronic
1072721918 10:97786485-97786507 TATTGGAAAGAGACGGCTCTAGG + Intergenic
1077394063 11:2312592-2312614 CAGTGGGCAGTGGAGGCTCTCGG - Intronic
1082810075 11:57474355-57474377 CACAGGAAGGTGGAGGCTGTGGG + Intronic
1083581335 11:63827293-63827315 CACTGGAAAGTGTCTGTTCCTGG + Exonic
1084150174 11:67284463-67284485 AGCCAGAAAGTGGCGGCTCTGGG + Intronic
1085375476 11:76056926-76056948 GACAGGAAAGTGTCAGCTCTGGG + Intronic
1086194076 11:84116115-84116137 CACTGGCAAGTGGGGCCTTTTGG + Intronic
1089882737 11:121790612-121790634 CAGTGGAATGTGGGGTCTCTAGG - Intergenic
1093113490 12:15181174-15181196 CCCTGGATAGTGGAGGCCCTTGG + Intronic
1093728776 12:22544498-22544520 CTCTCAAAAATGGCGGCTCTCGG + Intronic
1100395812 12:94185585-94185607 CAATGGCAAGAGGCAGCTCTAGG + Intronic
1103861899 12:124022098-124022120 CACTGGAAAGTGGCTGCTCTGGG - Intronic
1104063949 12:125291066-125291088 CACTGGAAAGTGGGGACCTTAGG + Intronic
1104944568 12:132409867-132409889 CACAGGACGGTGGCAGCTCTGGG - Intergenic
1108096273 13:46904535-46904557 CACTGGAAAGAGGAGCCTTTTGG + Intergenic
1110046839 13:70842242-70842264 CAGTGGAGAGTGGCAGCTGTGGG - Intergenic
1113673691 13:112194166-112194188 AACTGGAAACTGGCTGCTCAGGG - Intergenic
1116385948 14:44330075-44330097 CACAGGAAGGTGGTGGCTTTTGG - Intergenic
1118719390 14:68583571-68583593 CACTGGAATGTGGTGGCCTTGGG + Intronic
1118824407 14:69367309-69367331 TATTAGAAAGTGGGGGCTCTTGG + Intergenic
1122660368 14:103290835-103290857 CACTGGACAGTGGCTGGTCAGGG - Intergenic
1123167934 14:106344275-106344297 CACTGAAAACGGGCAGCTCTAGG - Intergenic
1123170572 14:106368988-106369010 CACTGAAAACGGGCAGCTCTAGG - Intergenic
1128281634 15:66399562-66399584 TACTGGGAAGTGGAGGCTCTGGG - Intronic
1132399558 15:101496984-101497006 TACTGTGAAGCGGCGGCTCTGGG - Intronic
1132867236 16:2099562-2099584 CACTGGAAAGTGGCGGCCCTAGG + Intronic
1132898108 16:2238369-2238391 CACTGGAAAGTGGTCGCTGATGG - Exonic
1133256747 16:4521768-4521790 AGCTGGAAAGTGGTGGGTCTTGG - Intronic
1134008994 16:10837297-10837319 CACTGGTAAGTGGCAGAGCTAGG + Intergenic
1134045742 16:11099630-11099652 CACTAGAAAGTGACGGAGCTGGG - Intronic
1134524538 16:14933553-14933575 CACTGGAAAGTGGCGGCCCTGGG - Intronic
1134548365 16:15127388-15127410 CACTGGAAAGTGGCGGCTCTGGG + Intronic
1134712127 16:16332040-16332062 CACTGGAAAGTGGCGGCCCTGGG - Intergenic
1134719984 16:16375333-16375355 CACTGGAAAGTGGCGGCCCTGGG - Intergenic
1134947442 16:18336552-18336574 CACTGGAAAGTGGCGGCCCTGGG + Intronic
1134954702 16:18376654-18376676 CACTGGAAAGTGGCGGCCCTGGG + Intergenic
1135521894 16:23183876-23183898 CACTAGAAAGTGGCTGAGCTGGG - Intronic
1137676207 16:50305018-50305040 CACTGGACAGAGGCTGCTCAGGG - Intronic
1139434288 16:66927116-66927138 CACTGGAAAGAGCCTCCTCTGGG + Intergenic
1139502914 16:67382572-67382594 CTCTGGAAAGTGCCTGCTATTGG + Intronic
1140893946 16:79308774-79308796 AGCTGGAAAGTGGCAGATCTAGG + Intergenic
1141050123 16:80754147-80754169 CTGTGCACAGTGGCGGCTCTTGG - Intronic
1151620141 17:75240285-75240307 CGCTGGAAAGTGGAGGTCCTTGG + Intronic
1151875826 17:76867922-76867944 CACTGGCTAGTGGAGGATCTGGG + Intergenic
1153520326 18:5946463-5946485 TACTTGACAGTGGTGGCTCTCGG - Intergenic
1155065915 18:22268659-22268681 CAGAGGAAAGTGGCGGGGCTAGG - Intergenic
1155553110 18:26987707-26987729 CACTGGGAAGTGGGGTCTTTTGG + Intronic
1157548054 18:48561436-48561458 GACTGGGAAGTGCAGGCTCTTGG + Intronic
1158349480 18:56550434-56550456 CACTAGTAAGTGGCGGAGCTGGG - Intergenic
1159955647 18:74516687-74516709 CCATGGTAAGGGGCGGCTCTGGG - Intronic
1160036024 18:75302519-75302541 CCCTGGACAGTGGGGGCCCTTGG + Intergenic
1161518957 19:4713073-4713095 CACTGGGATGTGGCTGCTCCTGG + Intronic
1161917363 19:7238766-7238788 CACTGGAAAGAGGCTCCTATGGG + Intronic
1161961209 19:7524221-7524243 TACTGTAAAGTGGCAGGTCTGGG + Intronic
1162843377 19:13372544-13372566 AACTGGAAAGTGGCAGATCTGGG - Intronic
1168103684 19:54154103-54154125 CACTGCAAAGGGGAGGCACTGGG - Intronic
926531734 2:14055506-14055528 CAGTGGAAAGTGGAGGCTGGTGG - Intergenic
927795228 2:26042190-26042212 CACTGGGAATTGGAGTCTCTCGG + Intronic
936480373 2:112879929-112879951 CTCTAGCAAGTGGAGGCTCTGGG + Intergenic
939766889 2:146261900-146261922 CACTTGAAAGTGACTGCTATGGG + Intergenic
940755329 2:157675366-157675388 CAGTGGGAAGTGGCAGCTCAAGG + Intergenic
942374700 2:175325028-175325050 CATTGGAAGGTGGTGGCTCACGG + Intergenic
947163651 2:227239916-227239938 GGCTTGAAAGTGGTGGCTCTTGG - Intronic
948733077 2:239979569-239979591 CCCTGTTAAGTGGGGGCTCTCGG + Intronic
948841213 2:240650364-240650386 CACCGGAAAGTGGGGTCACTCGG + Intergenic
948932813 2:241142961-241142983 CACTGGCAAGGGGAGGCTCTGGG + Exonic
1168951602 20:1805597-1805619 CACTGAAATGTGGCGGTGCTGGG - Intergenic
1171422042 20:25024118-25024140 CTCTGGACAGTGAAGGCTCTTGG - Intronic
1173179276 20:40790211-40790233 CACTGGAAAATGGCAAATCTAGG - Intergenic
1173997196 20:47347431-47347453 CACTGGAAAGTGGTGGTCTTGGG - Intronic
1174873065 20:54201356-54201378 CAGAGGACAGTGGCGGCTCCTGG - Intergenic
1175184130 20:57168319-57168341 CACTGGACAGTGTCAGCTCTGGG + Intergenic
1179090445 21:38260480-38260502 AATTGGATAGTGGCGGCTATTGG - Intronic
1182220949 22:28758289-28758311 CATTAGAAAGTTGTGGCTCTTGG - Intergenic
1182484274 22:30630026-30630048 CAATGGCAAGTGTCGGCACTGGG - Intergenic
1184171790 22:42764390-42764412 CACTGGAAGGTGGCGGAGCTGGG - Intergenic
950046255 3:9950136-9950158 GACTGGAAGGTGGGGGCTTTAGG - Exonic
950329158 3:12142673-12142695 GACTGGAAAGTGGCGGAGCTGGG + Intronic
952055510 3:29440306-29440328 CACAGGAAAGTGGGGGCAATTGG - Intronic
952554294 3:34514338-34514360 CACTGGAGAATGGCTGCTGTGGG - Intergenic
953711216 3:45272880-45272902 CACTGGATGTTGGGGGCTCTAGG - Intergenic
954264805 3:49463755-49463777 CACTGGAAAGTGTTGGATCCAGG + Intergenic
954986169 3:54794706-54794728 TACTTGAAAGTGGCTGCTCTAGG + Intronic
955371256 3:58354106-58354128 GACTAGAAAGTGGTGGATCTGGG - Intronic
955476560 3:59342055-59342077 CTCTGGCAGGTGGAGGCTCTGGG - Intergenic
956217075 3:66859664-66859686 CACTAGAAAGTGGCAGAGCTGGG + Intergenic
960512813 3:118571452-118571474 CTCTGGAAAGTGGCACCTCCGGG - Intergenic
961159810 3:124714426-124714448 CAATGGAAAGAAGCTGCTCTTGG + Intronic
961821302 3:129577063-129577085 CACAGGAAAGTGGCTGCTGACGG + Intronic
963140373 3:141941881-141941903 CACTAGTAAGTGGCTCCTCTAGG + Intergenic
965742982 3:171896244-171896266 TGCTGGAAAATGTCGGCTCTGGG + Intronic
968901793 4:3435541-3435563 CTCTGGAGAGAGGGGGCTCTAGG - Intronic
969273970 4:6122632-6122654 CACAAGCAAGTGCCGGCTCTAGG + Intronic
972219371 4:36936162-36936184 CAGGGGAAAGAGGCGGCTGTGGG + Intergenic
972285602 4:37644939-37644961 CGCTGGAAAGTGGCGGAGCTGGG - Intronic
973690095 4:53419368-53419390 CATTGTAAAGTGGCAGCACTAGG - Intronic
984988092 4:185350913-185350935 GCCTGGAAAGTGGCAGCACTGGG + Intronic
985204521 4:187521022-187521044 CTCTGGGAAGGGGCGGCTGTGGG + Intergenic
987319004 5:16750171-16750193 CACTGCAGACTGGCGTCTCTCGG + Intronic
989578210 5:43008285-43008307 CCGGGGAAAGTGGCGGCGCTAGG + Intergenic
992777592 5:80102124-80102146 CAGTGGACAGTGGTAGCTCTTGG - Intergenic
993088412 5:83393421-83393443 CACTGCAAAGTGGCAGCACAGGG + Intergenic
997518860 5:134509330-134509352 AACTGGAGAGTGGCGGAGCTGGG - Intergenic
999383964 5:151141188-151141210 CACTGAAAAGTGGGGGGTCTGGG + Intronic
999450680 5:151675612-151675634 GACTGGAAAAGGGCAGCTCTAGG - Intronic
1001185651 5:169568960-169568982 CACTGCAAAGGGGCTGCTCATGG + Intergenic
1002895885 6:1379884-1379906 CACTGCAAAGAGGGAGCTCTGGG - Intergenic
1006298287 6:33179680-33179702 CCCTGGAAAGGGAAGGCTCTGGG - Intronic
1008992466 6:57618931-57618953 CTCTGGAAAGTGCCACCTCTTGG + Intronic
1016066724 6:139690901-139690923 CAATGGAAAGTGTGGGCTCCTGG + Intergenic
1017604485 6:156119306-156119328 CACTGCAAATTGCAGGCTCTTGG - Intergenic
1019757769 7:2786078-2786100 CACTGGAAAGGGGCGGCATGAGG + Intronic
1019905093 7:4056745-4056767 CACTGCATAGTAGCTGCTCTGGG - Intronic
1024118012 7:46211081-46211103 CACGGGGAAGTGGGGGCTCAGGG + Intergenic
1024250353 7:47501519-47501541 TGCTGGAGAGTGGAGGCTCTGGG + Intronic
1030005364 7:105112910-105112932 CACTGGAAGGTGGCGGCGGAGGG - Exonic
1034546749 7:151794385-151794407 CACTGGAAAGTGGAGGTTCCTGG - Intronic
1034936721 7:155204719-155204741 CACTGGAAAGGTGAGGCTTTGGG - Intergenic
1034986328 7:155517672-155517694 CACGGCAAAGTGGGGGCACTGGG + Intronic
1036751724 8:11447718-11447740 CTCTGGAGAGTGTGGGCTCTGGG + Intronic
1037610139 8:20469146-20469168 AACTGGTAGGTGGCGGATCTGGG - Intergenic
1038745398 8:30250095-30250117 CAATGGGTAGTGGCGGCTGTGGG + Intergenic
1040850275 8:51894086-51894108 GACTGGGAGGTGGGGGCTCTAGG + Intronic
1047878716 8:129169339-129169361 CACTGGAAAATGGAGGCATTTGG + Intergenic
1047940881 8:129826535-129826557 CACTGGTAAGTGACAGCCCTAGG - Intergenic
1049192368 8:141295372-141295394 AACTTGAAGGTGGCGGCCCTGGG - Intronic
1050969411 9:11849970-11849992 CACTGGAAAATGGCAGCAGTAGG + Intergenic
1052321356 9:27170951-27170973 CACTGAAACGTGTCTGCTCTAGG + Intronic
1053218249 9:36290495-36290517 CACTGGAAAGGGGAGACCCTTGG - Intronic
1056332635 9:85534414-85534436 CACAGGAGAGTGGGGGCGCTGGG + Intergenic
1059346521 9:113632629-113632651 CCCTGGAAGGTGGGGGCCCTAGG + Intergenic
1060878556 9:127101296-127101318 GACTGGAAAGTGGAGGATCTGGG + Intronic
1186192181 X:7076687-7076709 CATTGGAAAGTGGCAGCTGGTGG - Intronic
1191676018 X:63793289-63793311 CCCTGGAAAGTAGGGGGTCTTGG + Intergenic
1193556548 X:82960849-82960871 CTCTGGAAAGTGCCACCTCTTGG + Intergenic
1195537176 X:106022173-106022195 CTCTGGAAAGTGGCAGCCCAAGG - Intergenic
1196027270 X:111054294-111054316 CACTGGAAAGTGGCTTCACTGGG - Intronic
1196968377 X:121083221-121083243 CACTGCAAAGAGGACGCTCTTGG - Intergenic