ID: 1134548366

View in Genome Browser
Species Human (GRCh38)
Location 16:15127393-15127415
Sequence GAAAGTGGCGGCTCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 6, 2: 4, 3: 24, 4: 259}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134548355_1134548366 22 Left 1134548355 16:15127348-15127370 CCGAGCAGCCTTTGGTGGACGCC No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259
1134548361_1134548366 -5 Left 1134548361 16:15127375-15127397 CCTCTGGCTGCAGCACTGGAAAG No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259
1134548356_1134548366 14 Left 1134548356 16:15127356-15127378 CCTTTGGTGGACGCCTTTCCCTC No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259
1134548354_1134548366 23 Left 1134548354 16:15127347-15127369 CCCGAGCAGCCTTTGGTGGACGC No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259
1134548352_1134548366 27 Left 1134548352 16:15127343-15127365 CCTTCCCGAGCAGCCTTTGGTGG No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259
1134548360_1134548366 -4 Left 1134548360 16:15127374-15127396 CCCTCTGGCTGCAGCACTGGAAA No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259
1134548358_1134548366 1 Left 1134548358 16:15127369-15127391 CCTTTCCCTCTGGCTGCAGCACT No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259
1134548351_1134548366 28 Left 1134548351 16:15127342-15127364 CCCTTCCCGAGCAGCCTTTGGTG No data
Right 1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG 0: 1
1: 6
2: 4
3: 24
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134548366 Original CRISPR GAAAGTGGCGGCTCTGGGCA TGG Intronic
900462232 1:2807185-2807207 GAAAGTGGGGGCCCTGGTAAAGG + Intergenic
900613102 1:3552794-3552816 AAAAGTGGGGGGTCTGGGCCCGG - Intronic
901095315 1:6674268-6674290 AAAAGTGGGGGGGCTGGGCACGG + Intronic
901170274 1:7252033-7252055 TAAAGTGGGGGCTATGGCCAGGG - Intronic
901631747 1:10651438-10651460 GAAAGTGGCAGATCTGGACTGGG + Intronic
902702835 1:18184344-18184366 GAGAGTGGAGGCCCTGGGGAGGG - Intronic
902893645 1:19463624-19463646 GAAAGTGGTGGAGGTGGGCATGG - Intronic
903780361 1:25816567-25816589 GACAGTGCCGGCTCTGGAGAAGG - Exonic
903975832 1:27149571-27149593 GAAAGTGACTGCTGTGGGCTGGG + Intronic
905468078 1:38170841-38170863 CAAAATGGCTGCTTTGGGCAAGG + Intergenic
905643773 1:39610201-39610223 GAATTTGGCGGCTCTGAGCCGGG + Intergenic
906104994 1:43286271-43286293 GACAGTGGGTGCTCTGGGCATGG - Intergenic
907857624 1:58319129-58319151 GAAAGAGGGGGCTGGGGGCAGGG + Intronic
911205878 1:95091346-95091368 GAAAGAGACGGCTCTGGCCTTGG - Intergenic
915162549 1:153930554-153930576 GACAATGGCTGCTCTGGGCAAGG - Exonic
916316616 1:163455470-163455492 GTAAGTGGCAGTTCTGGGTAGGG + Intergenic
917418835 1:174840519-174840541 GAAAGCGGGGGTGCTGGGCACGG + Intronic
919927884 1:202201827-202201849 GAAATTGGGGACTCTGGGGAGGG + Intronic
920124897 1:203686387-203686409 AACAGTGGCAGCTCTGGGAAGGG - Intronic
921006790 1:211101499-211101521 GCCAGTGGGGGCTCTGGACAAGG - Intronic
922297701 1:224265921-224265943 GAAAGTGGCCAAGCTGGGCATGG - Intronic
923148723 1:231215619-231215641 GACAGTGGCAGCTGTGAGCATGG - Exonic
923226468 1:231942710-231942732 AAATGTGGCGCCTCTGGCCATGG - Intronic
1062824320 10:557149-557171 GAAAGGAGCAGCCCTGGGCAGGG + Intronic
1064341196 10:14487124-14487146 GAGAGTAGCAGCTCAGGGCAGGG + Intergenic
1065128464 10:22596856-22596878 GGAGATGGAGGCTCTGGGCAGGG - Intronic
1070596097 10:77834227-77834249 GAATGTGGAGGACCTGGGCAGGG + Intronic
1070854248 10:79593869-79593891 GAAAGTGGGGGCTCAGAGCCAGG + Intergenic
1072581275 10:96742025-96742047 GAAAGAGGAGGGACTGGGCACGG + Intergenic
1073201284 10:101737901-101737923 AAAAGAGATGGCTCTGGGCATGG + Intergenic
1073289364 10:102405744-102405766 GACAGTGGTGGCTCTAGGCTGGG - Intronic
1073490577 10:103850557-103850579 GAAAGAGGTTGCTCTGGGTAAGG - Intronic
1073757938 10:106601030-106601052 GAAAGTGGCCCCTCTGAGGATGG - Intronic
1074291356 10:112140109-112140131 AAAAGTGGCAGCAATGGGCATGG - Intergenic
1075212524 10:120503098-120503120 CAAAATGGCGGCCCTGGCCATGG - Intronic
1075390061 10:122085444-122085466 GAAACTTGCTGCACTGGGCAGGG + Exonic
1075546499 10:123358917-123358939 GGAAGTGGAGGCTGTGGACAGGG + Intergenic
1076414666 10:130277219-130277241 GAGGGTGGGGGCTCTGGACATGG + Intergenic
1076785341 10:132746938-132746960 GAATGAGGCAGCTCTGGGGAGGG + Intronic
1077202590 11:1318806-1318828 GAAAGTTGATGCTCTGGGCCGGG + Intergenic
1077362756 11:2147967-2147989 GAAAGAGGGAGCTCTAGGCAGGG - Intronic
1077536930 11:3128990-3129012 GTAAGTGCCGGCCGTGGGCAGGG - Intronic
1077683867 11:4272641-4272663 GAATGAGGAGACTCTGGGCATGG + Intergenic
1077686175 11:4294123-4294145 GAATGAGGAGACTCTGGGCATGG - Intergenic
1077691324 11:4345287-4345309 GAATGAGGAGACTCTGGGCATGG - Intergenic
1078047414 11:7928491-7928513 GAACGTGGAGGCTCTGGTCTAGG + Exonic
1078581614 11:12543373-12543395 GAAAGTGGGGGTTCTGGCTAGGG + Intergenic
1079205677 11:18412484-18412506 GAAAGTGGTGGCTGGGGGCAGGG + Intronic
1079876169 11:25859720-25859742 GAAAGTGGCTGCTCTGTAAAAGG + Intergenic
1081806117 11:45891522-45891544 GAAACTTGCAGCTCTGGGGAGGG + Intronic
1082219041 11:49610349-49610371 GGAAGTGGGGGCACTGGGAAGGG - Intergenic
1082830390 11:57612710-57612732 GAAAATGGAGTCTCTGGGCTGGG - Intronic
1083291733 11:61694338-61694360 GTAAATGGCTGCTCAGGGCAGGG + Intronic
1083737192 11:64688136-64688158 GAAAGAGGCGGGTCTGGGGCTGG + Intronic
1084169944 11:67396253-67396275 GAAGATGGCGGGCCTGGGCAGGG - Exonic
1084419723 11:69054221-69054243 GAGGGTGGAGCCTCTGGGCACGG + Intronic
1084590159 11:70085695-70085717 GAGAGAGGAGGCTCTGGGCCAGG - Intronic
1084601703 11:70149698-70149720 GAAGGTGGCAGCTGCGGGCAGGG - Exonic
1084787808 11:71453479-71453501 GAAACTCTCGGCCCTGGGCATGG + Intronic
1086140656 11:83495167-83495189 GACAGTGGTGGCAGTGGGCAGGG + Intronic
1091078257 11:132641337-132641359 GAAAGTGGCAGCTCTGGGCAAGG - Intronic
1096092777 12:48914445-48914467 GCAAGTGGCTGCGCAGGGCATGG - Exonic
1097195098 12:57238750-57238772 GACAGCGGCGGCTCTGGAAAAGG - Intronic
1097691557 12:62738972-62738994 GAAAGTGGGGGGTCGGGGCGGGG + Intronic
1100114591 12:91288865-91288887 GAAAGTGGCTACTTTGGGGAAGG + Intergenic
1102179611 12:110902476-110902498 GAATGTGGAGGAACTGGGCATGG - Intronic
1102830721 12:115996493-115996515 GAAAGTGGCTGCAGGGGGCATGG + Exonic
1102978723 12:117225125-117225147 GAAGCTGGGTGCTCTGGGCAAGG + Exonic
1103389131 12:120557757-120557779 GAAAGTGAAGCCTTTGGGCAGGG + Intronic
1103401835 12:120648588-120648610 GAAGCTGGCAGCGCTGGGCATGG + Intronic
1103737183 12:123068074-123068096 GAAAGTGGGGAGGCTGGGCAGGG - Intronic
1103861897 12:124022093-124022115 GAAAGTGGCTGCTCTGGGGCAGG - Intronic
1104688749 12:130808168-130808190 GTAAGAGGCGGATCTGGGCACGG + Intronic
1106000841 13:25721611-25721633 GTAAGTGGCTGCTTAGGGCAGGG - Intronic
1106635735 13:31526641-31526663 GAAAGTGGCTTCTCTCTGCATGG - Intergenic
1109706469 13:66099801-66099823 GAATGTGGAGGCTTTGGGCCCGG + Intergenic
1112656446 13:101456617-101456639 AAAAGTGTGGGCTCTGGGCTGGG + Intronic
1113709430 13:112453999-112454021 GGAACTGGGGGCTCTGGGCAGGG + Intergenic
1113966241 13:114155370-114155392 GAGGGTGGGGGCTTTGGGCAGGG + Intergenic
1115648150 14:35384402-35384424 GGAAGTGAGGGCTCTGGGGACGG - Intergenic
1116651264 14:47595741-47595763 GAAAGTGCCCACTCTAGGCAAGG + Intronic
1118271037 14:64342341-64342363 GCAAGTGGAGGCTCTGGTCAAGG + Intergenic
1119042104 14:71284050-71284072 GAAAGTGGGGGCTGGGGGGAGGG + Intergenic
1119157539 14:72424817-72424839 GAAAGTTTTGGTTCTGGGCAGGG - Intronic
1122016811 14:98803417-98803439 GACAGTGGCGGCCCTGGCCGTGG + Intergenic
1122788625 14:104175242-104175264 GCCGGTGGCGGCTCAGGGCAGGG - Exonic
1123038014 14:105479129-105479151 GAAGGTGACGTCTCTGGGCAAGG + Exonic
1124718740 15:32093413-32093435 GGATGGGGCAGCTCTGGGCATGG + Intronic
1125392365 15:39207740-39207762 TAAAGAGGAGGCACTGGGCAGGG - Intergenic
1125582443 15:40795916-40795938 GTGAGTGCCTGCTCTGGGCAAGG + Intronic
1126134609 15:45378285-45378307 GAAGGTGGCGGCTCCGGGCAGGG + Intronic
1127464539 15:59231424-59231446 GAAAGTGGCAGCTTTGGCCTTGG - Intronic
1127732737 15:61815501-61815523 GAAAGTGGCTGCTGTGTTCAAGG + Intergenic
1128281631 15:66399557-66399579 GGAAGTGGAGGCTCTGGGGAGGG - Intronic
1128398719 15:67254975-67254997 GGAAGTGGCGCGGCTGGGCAGGG - Intronic
1131367495 15:91853242-91853264 GAGACTGGCGGCTCTGCGCCGGG - Intergenic
1131389302 15:92034142-92034164 GAAAGTGGGGGCTGTATGCAGGG + Intronic
1131438113 15:92439008-92439030 GAGAGTGGAGTCACTGGGCACGG + Intronic
1132867237 16:2099567-2099589 GAAAGTGGCGGCCCTAGGCATGG + Intronic
1134524537 16:14933548-14933570 GAAAGTGGCGGCCCTGGGCATGG - Intronic
1134548366 16:15127393-15127415 GAAAGTGGCGGCTCTGGGCATGG + Intronic
1134712126 16:16332035-16332057 GAAAGTGGCGGCCCTGGGCATGG - Intergenic
1134719983 16:16375328-16375350 GAAAGTGGCGGCCCTGGGCATGG - Intergenic
1134947443 16:18336557-18336579 GAAAGTGGCGGCCCTGGGCATGG + Intronic
1134954703 16:18376659-18376681 GAAAGTGGCGGCCCTGGGCATGG + Intergenic
1135994704 16:27239158-27239180 GAATGTGTCGGGGCTGGGCACGG - Intronic
1136100690 16:27993429-27993451 GAAAGTGGGGACTCTAGGCCAGG - Intronic
1136365861 16:29808989-29809011 GAACTTGGCTGCTCTGGGGAAGG + Intronic
1137491594 16:48937611-48937633 GAGAGTGGCGGCACAGGGCCTGG + Intergenic
1138290915 16:55846091-55846113 GAAAGTGGGTGCTGGGGGCATGG + Intergenic
1141628201 16:85272579-85272601 GAAAGGGCCAGCTCTGAGCACGG - Intergenic
1141643650 16:85356055-85356077 AAAAGTGAGGGCTGTGGGCATGG + Intergenic
1141940510 16:87273090-87273112 GGAAGTGGCTGCTCAGGGAATGG - Intronic
1143239397 17:5431121-5431143 GACAGTGCCGGCTCTGGGGTGGG + Intronic
1143378196 17:6479584-6479606 GGAAGGGCAGGCTCTGGGCAGGG - Intronic
1143731954 17:8886445-8886467 GGAAGAGGCGGTTCGGGGCAGGG + Intronic
1143917812 17:10306873-10306895 GAAAGTGGGGCCTCTGAGCCAGG - Intronic
1144029368 17:11305762-11305784 GCAGGTGGAGGCTCGGGGCAGGG - Intronic
1144514792 17:15909911-15909933 GACTGGGGCGGCTCTGGGGAGGG - Intergenic
1144586612 17:16491551-16491573 GAATGTGGGGCCTCAGGGCAGGG - Intronic
1144798741 17:17911127-17911149 GATAGTGCTGGCTCTGAGCATGG - Intronic
1146376813 17:32300139-32300161 GAAAGTGGTGGAGCTGGGCAGGG + Intronic
1147460474 17:40565092-40565114 GAGAGTGGCGGGGCTGGGCTTGG - Intronic
1147562791 17:41519410-41519432 GAGAGTGGAGGCCCTGGGGATGG + Exonic
1147746402 17:42697432-42697454 GAAAGTGAAGGCCCTGGGAATGG + Intronic
1148439825 17:47706219-47706241 GAAGGAGAGGGCTCTGGGCAGGG - Intronic
1148505317 17:48122427-48122449 GAAAGAGAGGGCTCTGGGGATGG + Exonic
1149286150 17:55166648-55166670 TAGAGTGCCAGCTCTGGGCATGG - Intergenic
1150432064 17:65126415-65126437 GAAAGTGGAGGCTTTGCCCAGGG + Intergenic
1152269151 17:79313676-79313698 GGAAGGGGAGGCTCTGAGCAAGG - Intronic
1152426447 17:80220830-80220852 GAGGGTGGCGGCTCTGCGCGCGG + Intronic
1153829911 18:8912897-8912919 GTAACAGGCGGCTCTGGGGATGG - Intergenic
1157646142 18:49274176-49274198 GAAAGTGGTTCCTTTGGGCAGGG - Intronic
1160446651 18:78933287-78933309 GAACGAGCCGGCTCTGTGCACGG + Intergenic
1160825884 19:1080436-1080458 GAAAGAGGCGTCTCTGGTGAAGG - Intronic
1160939443 19:1613526-1613548 GCAAGTGGCTGCTCTGAGCAGGG - Intronic
1161436399 19:4266243-4266265 TAAAGTTGTGGCTCTGGGCCGGG - Intronic
1161729599 19:5951328-5951350 GAAAGTGGCTGGTCTGGGTTGGG + Intronic
1162510207 19:11113372-11113394 GAACGTGGTCGCTCTGGACACGG + Exonic
1162932316 19:13963230-13963252 GAAGCTGGCGGCGCTGCGCAGGG + Exonic
1163717281 19:18879708-18879730 GAAAGGGGAGGGACTGGGCAGGG - Intronic
1164952110 19:32345617-32345639 CAAAATGGCGGCGCTGGGGACGG - Exonic
1165227704 19:34366057-34366079 GAAAGTGGAAGCCCTGGGAAGGG + Intronic
1165936415 19:39391542-39391564 GCAGGAGGCCGCTCTGGGCAGGG - Exonic
1167842053 19:52130268-52130290 GGAAGAGGCTGCACTGGGCATGG - Intronic
1167874711 19:52402217-52402239 GGAAGAGGCTGCACTGGGCATGG + Intronic
1167887942 19:52517265-52517287 GGAAGAGGCTGCACTGGGCATGG + Intergenic
1167895120 19:52574351-52574373 GGAAGAGGCTGCACTGGGCATGG + Intronic
1167902807 19:52634852-52634874 GGAAGAGGCTGCACTGGGCATGG - Intronic
1167910604 19:52698940-52698962 GAAAGAGGCTGCACTGGGCATGG - Intergenic
1167921790 19:52788123-52788145 GGAAGAGGCTGCACTGGGCATGG - Intronic
1167933755 19:52890030-52890052 GGAAGAGGCTGCACTGGGCATGG - Intronic
1167944956 19:52980678-52980700 GGAAGAGGCTGCACTGGGCATGG - Intergenic
1167958318 19:53086053-53086075 GGAAGAGGCTGCACTGGGCATGG - Intronic
1167966688 19:53153520-53153542 GGAAGAGGCTGCACTGGGCATGG - Intronic
1167987287 19:53329255-53329277 GATAGGGGCGGGTCTGGGAAAGG + Intergenic
1167988961 19:53341511-53341533 GGAAGAGGCCGCACTGGGCATGG + Intronic
1167992541 19:53372482-53372504 GGAAGAGGCTGCACTGGGCATGG + Intronic
1167995456 19:53398218-53398240 GGAAGAGGCTGCACTGGGCATGG + Intronic
1168001216 19:53447472-53447494 GGAAGAGGCTGCACTGGGCATGG + Intronic
1168005596 19:53484026-53484048 GGAAGAGGCTGCACTGGGCATGG + Intronic
1168139251 19:54374360-54374382 GAAGGAGGCAGCTCTGTGCAAGG + Intergenic
925216739 2:2102967-2102989 GAAAGTGAGTGCTCTGTGCAGGG + Intronic
925349391 2:3190225-3190247 GAAAGTGGCCGCTGTGAGCCGGG - Intronic
925844112 2:8020388-8020410 GAAAGTGGAGCCTCTGGGCAGGG - Intergenic
926105334 2:10146268-10146290 GAAAGAGGCAGCCCAGGGCATGG - Intronic
926194691 2:10755655-10755677 GAGAGTGGTGGCTCTGGAGAGGG - Intronic
926761893 2:16285440-16285462 GAAAGTTGCGGCTGTCGCCAGGG + Intergenic
927177850 2:20422758-20422780 GAAAGAGGCAGCTAGGGGCAGGG - Intergenic
927944582 2:27127920-27127942 AAAAGTCGGGGTTCTGGGCAGGG - Intronic
929681220 2:43995590-43995612 GAAGGTCACGGCTGTGGGCATGG - Intronic
931668163 2:64624899-64624921 GAAAGTGTGGGCTCTGGGCAGGG - Intergenic
932301053 2:70667235-70667257 GAAAATGGGGGCTCTGTCCAAGG + Intronic
932309763 2:70730248-70730270 GAAAGTGACTGCTCTGGGGTTGG + Intronic
932812808 2:74838307-74838329 GGAAGTGGAGGAGCTGGGCAGGG + Intronic
933565558 2:83946307-83946329 GAAAATGACAGTTCTGGGCATGG - Intergenic
933842098 2:86295991-86296013 GAAAGAGGTAGCTCTGAGCATGG + Intronic
936390103 2:112064692-112064714 GAAAGTGGCTGTGCTGAGCAAGG + Intronic
936463787 2:112729523-112729545 GAAGTTGGCAGCTGTGGGCAGGG + Intronic
936472813 2:112813936-112813958 GAAAGTGGAGGCTCAGAGAAAGG - Intergenic
937324907 2:120984788-120984810 GCAAGGGGTGGCCCTGGGCACGG - Intronic
938015770 2:127865900-127865922 GAAAGAGATGGCTCTGGGTAAGG - Intronic
942137606 2:172943402-172943424 GAAACTGGCAGCTCTGGGATAGG - Intronic
942590474 2:177540467-177540489 GAAAGTGGGGGCTGGGGGTAGGG - Exonic
943133282 2:183883242-183883264 GAAAGTGGTGACTTTGGGCAGGG - Intergenic
944414224 2:199467309-199467331 GAAACTGGCCGGTCTGGACAAGG - Intronic
947729500 2:232420159-232420181 GAAGGGGGAGGCGCTGGGCACGG + Intergenic
947736755 2:232459200-232459222 GGAAGTGGCGGCTCAGGACGGGG - Exonic
948044202 2:234930499-234930521 GAAAGAGGCAGTTCTGGGAAAGG - Intergenic
948932814 2:241142966-241142988 GCAAGGGGAGGCTCTGGGAAAGG + Exonic
1171245843 20:23608847-23608869 CAAAGGGGCAGCTCGGGGCAGGG + Intergenic
1172032434 20:31991316-31991338 GAATGTGGCGGCAGTGGGGATGG + Intronic
1173644557 20:44625530-44625552 GAGACGGGCGGCCCTGGGCAGGG + Intronic
1174052513 20:47776887-47776909 GAAGGTGACTGCTCAGGGCAAGG - Intronic
1174117686 20:48238505-48238527 TCACGTGGAGGCTCTGGGCAAGG + Intergenic
1175727257 20:61327581-61327603 GAAAGTGGGTGCTCAGGGCTGGG + Intronic
1176084641 20:63290393-63290415 GAAAGTGGCGGGTCCCGGCCAGG + Intergenic
1176092610 20:63325718-63325740 AAAGGTGCCGGCTCTGGGCTTGG + Exonic
1179657260 21:42853105-42853127 GACAGTGGGGTCTCTGGGCGAGG - Intronic
1180961258 22:19763387-19763409 GAAAGTGGCGGGTCTCCGCCTGG + Intronic
1180995616 22:19963792-19963814 AAAAGGGCCGGCTGTGGGCAGGG + Intronic
1181049985 22:20233851-20233873 GGAAGGGAGGGCTCTGGGCAGGG + Intergenic
1183071372 22:35398949-35398971 GAATGAGGCCGGTCTGGGCATGG + Intergenic
1183213264 22:36463975-36463997 GAATGTGTGGGCTCTGGGCAGGG - Intergenic
1184391300 22:44205021-44205043 GCAAGGGGAGGCCCTGGGCAGGG + Intronic
1184455894 22:44609223-44609245 GGAGTTGGGGGCTCTGGGCAGGG + Intergenic
1184599744 22:45536249-45536271 GAAGGTGCCGGGGCTGGGCAGGG + Intronic
1184698031 22:46150587-46150609 GAAGGAGGCGGCGCCGGGCAGGG - Intronic
949286873 3:2416947-2416969 GAAAGTTGCGACACTGGGCCGGG - Intronic
950111499 3:10421619-10421641 GAAGGTTGCGGATCAGGGCAGGG - Intronic
950329159 3:12142678-12142700 GAAAGTGGCGGAGCTGGGAGAGG + Intronic
954801430 3:53189243-53189265 GAAGGTGGAGGCCCTGGGCTGGG + Exonic
955371255 3:58354101-58354123 GAAAGTGGTGGATCTGGGAGAGG - Intronic
961831943 3:129627400-129627422 CAAATTGGCCGCTCTGGGCCAGG + Intergenic
963035103 3:141019263-141019285 GCAAGTGGGGGCTCTTGGCGAGG + Intergenic
964766327 3:160181574-160181596 GAGAGTGGGGCCTCTGGGAAAGG + Intergenic
965680661 3:171247999-171248021 GAAAGGGGCAATTCTGGGCAAGG + Intronic
968077705 3:195825411-195825433 GGAAGAGGCGGCTCTTGGCCAGG + Intergenic
968672660 4:1860174-1860196 AAAAGTGGTGGCTTTGGGCTGGG + Intergenic
971027427 4:22602362-22602384 GAATGTGGGGGCCCTGGCCAAGG + Intergenic
972285601 4:37644934-37644956 GAAAGTGGCGGAGCTGGGATTGG - Intronic
976195556 4:82528538-82528560 GAGAGAGGGGGCTGTGGGCAGGG - Intronic
977338484 4:95728400-95728422 GAAAGTGTGGTCTCTGGCCAAGG - Intergenic
979588209 4:122445894-122445916 GGAAGCGGCGGCTGTGGGCACGG - Intergenic
982782088 4:159501842-159501864 GAAAGAAGGGGCTTTGGGCAAGG - Intergenic
985119745 4:186628196-186628218 GCAGGTGACGGCTCTGGACAAGG - Exonic
985478821 5:94518-94540 GAAAGTGTTGGTTCTGGGCCTGG + Intergenic
989578211 5:43008290-43008312 GAAAGTGGCGGCGCTAGGAGAGG + Intergenic
990202477 5:53392668-53392690 TAAAGTGGCTATTCTGGGCATGG - Intergenic
997267268 5:132502141-132502163 GGAAGTGGCTGCCCAGGGCATGG - Intergenic
997471651 5:134120611-134120633 GAAGGTGGCGGCTATGTGCAGGG - Intronic
997518859 5:134509325-134509347 GAGAGTGGCGGAGCTGGGAATGG - Intergenic
998404008 5:141863423-141863445 GATAGTGGCGGCCCAGGTCAGGG + Exonic
999868726 5:155728728-155728750 GAAGTTGGCGGCTCTGGGGGCGG - Intergenic
1000189116 5:158891519-158891541 GAAAGTGATGGCTCTGGAAATGG - Intronic
1001451401 5:171827732-171827754 AAAAGTGGTGGATCTGGGCTGGG + Intergenic
1001493671 5:172173180-172173202 CAAAGTGGCGGTTGTGGGGAGGG + Intronic
1001683306 5:173574890-173574912 GAAAGAGGAACCTCTGGGCAAGG - Intergenic
1001838372 5:174852015-174852037 GAGAATGGTGGCTCTGGACAAGG + Intergenic
1002568770 5:180128544-180128566 GAAGCTGGCGGCTCTGCGCCAGG - Exonic
1002947116 6:1773050-1773072 GACAGAGGAGGCTCTTGGCAAGG + Intronic
1004768030 6:18753493-18753515 GAATCTGTCAGCTCTGGGCAGGG + Intergenic
1007696424 6:43736897-43736919 GAAGCTGGAGGCTGTGGGCATGG + Intergenic
1010613822 6:77989480-77989502 GAAAGAGGAGGTGCTGGGCACGG + Intergenic
1012560318 6:100572160-100572182 GGAAGTGGGGGCTTTGGGGAGGG + Intronic
1013156034 6:107491237-107491259 GAGAGGCGCGGGTCTGGGCACGG + Intronic
1019344326 7:522071-522093 GAATGTGGCGGGGCCGGGCAGGG - Intergenic
1019770772 7:2882611-2882633 GCCAGTGCGGGCTCTGGGCAGGG + Intergenic
1021097050 7:16547086-16547108 CACAGTGGAGGCTCTGGGCCTGG - Intronic
1023663286 7:42493342-42493364 GAAGGTGGGGGCTCCGGGGAGGG + Intergenic
1024131317 7:46355331-46355353 GAATGAGGCAGCTCAGGGCAGGG + Intergenic
1024247875 7:47484062-47484084 GAATGTGGAGGCTCAGGGCAAGG - Intronic
1025635655 7:63317555-63317577 GAAAGGGGAGGGTCTGGGGAGGG - Intergenic
1025647041 7:63430625-63430647 GAAAGGGGAGGGTCTGGGGAGGG + Intergenic
1027052948 7:75031211-75031233 GATGGTGGGGGCTCTGGGCAGGG - Intronic
1027976125 7:85158347-85158369 GAAAATGGCCGCTTTGGGGACGG + Intronic
1029166089 7:98592116-98592138 GACTGTGGCAGCTCAGGGCAAGG + Intergenic
1032723497 7:134570114-134570136 TAAAATGGCTGCTCTGGGGACGG + Intronic
1033652162 7:143351798-143351820 GAGAGAGGGGGCTCTGGGGAAGG - Exonic
1034210623 7:149359094-149359116 TACAGTGGAGGCTCTGGGCCTGG + Intergenic
1034986329 7:155517677-155517699 CAAAGTGGGGGCACTGGGCTCGG + Intronic
1037610138 8:20469141-20469163 GTAGGTGGCGGATCTGGGCTAGG - Intergenic
1037768176 8:21784446-21784468 GAGAGTGGCTGTTCTGGGTAGGG - Intronic
1038774667 8:30517987-30518009 GAAAGCAGCAGCACTGGGCAGGG + Intronic
1039921319 8:41896290-41896312 GCAAGTGGCTGCTGGGGGCAGGG - Intronic
1040736604 8:50515853-50515875 GGAAGGGGCGGCTGTGGGCACGG + Intronic
1043409765 8:79981948-79981970 CAAAGTTAAGGCTCTGGGCAGGG + Intronic
1045409413 8:101902531-101902553 CAATGTGGCTGCTCTGGGCAAGG + Intronic
1048488361 8:134869275-134869297 GAAAGTAGAGGCAGTGGGCAAGG + Intergenic
1049445946 8:142631610-142631632 GACAGTGGCTGTTCTTGGCAGGG - Intergenic
1049724795 8:144140744-144140766 GCAGGTGGGGGCTCTGGCCAGGG - Exonic
1051437912 9:17052773-17052795 GAAGGAGGCAGCTATGGGCATGG + Intergenic
1053555430 9:39132471-39132493 GAAAGTGGCGGGGCTGAGGAAGG + Intronic
1053819548 9:41952722-41952744 GAAAGTGGCGGGGCTGAGGAAGG + Intronic
1054109815 9:61096375-61096397 GAAAGTGGCGGGGCTGAGGAAGG + Intergenic
1054611042 9:67234750-67234772 GAAAGTGGCGGGGCTGAGGAAGG - Intergenic
1056981726 9:91318832-91318854 GAAAGTGGCAGTTTTGGGAAAGG + Intronic
1059055994 9:110980356-110980378 GAAAGTGGTAGCTCTGGGGAAGG + Intronic
1059392551 9:114008260-114008282 GGCAGAGGCAGCTCTGGGCAGGG + Intronic
1060191176 9:121593956-121593978 GAAAGTGGGAGGGCTGGGCATGG - Intronic
1060224778 9:121784086-121784108 GACAGTGGCTGCTCTGGGAAGGG + Exonic
1061731083 9:132614539-132614561 AAAAGTGCAGGCTCTTGGCATGG - Intronic
1061830770 9:133292883-133292905 CACAGTGGGGTCTCTGGGCAAGG + Intergenic
1062530361 9:136996911-136996933 GAAGGGGGCGGCTCTGGGTCAGG + Intergenic
1185479741 X:437486-437508 GAAGGAGGCGGCTCTGGGAGTGG - Intergenic
1185481991 X:453586-453608 AAAAGTGACGTCACTGGGCACGG - Intergenic
1185600349 X:1334897-1334919 CAAGGTGGAGGCTCTGGGGAAGG + Intergenic
1190775496 X:53549330-53549352 CCCAGTGGCGGGTCTGGGCATGG + Exonic
1190879565 X:54483073-54483095 GAAAGTGGCGGACCTGGGTCTGG + Intronic
1191029328 X:55951183-55951205 GAGATTGTGGGCTCTGGGCACGG + Intergenic
1191148063 X:57189993-57190015 GAAAGGGGCAGCTGTGGGCGCGG - Intergenic
1191858204 X:65644591-65644613 GACAGTGGCAGCTCAGGGCAGGG + Intronic
1196116628 X:112005966-112005988 GAAGGTGGCGGCGGGGGGCAGGG + Intronic
1196584120 X:117409545-117409567 GAAGGTGGCTGCTCAGGGCAGGG - Intergenic