ID: 1134548485

View in Genome Browser
Species Human (GRCh38)
Location 16:15127943-15127965
Sequence CCACCCTGCCCAACCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134548475_1134548485 23 Left 1134548475 16:15127897-15127919 CCTAGAAGGCAGGGAGGGCCGCA No data
Right 1134548485 16:15127943-15127965 CCACCCTGCCCAACCTCCCACGG No data
1134548480_1134548485 5 Left 1134548480 16:15127915-15127937 CCGCACTGCAGGAGGCCACGGGG No data
Right 1134548485 16:15127943-15127965 CCACCCTGCCCAACCTCCCACGG No data
1134548483_1134548485 -10 Left 1134548483 16:15127930-15127952 CCACGGGGCAGGACCACCCTGCC No data
Right 1134548485 16:15127943-15127965 CCACCCTGCCCAACCTCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134548485 Original CRISPR CCACCCTGCCCAACCTCCCA CGG Intronic
No off target data available for this crispr