ID: 1134548981

View in Genome Browser
Species Human (GRCh38)
Location 16:15130558-15130580
Sequence TGCCCGGGTTACAGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134548981_1134548987 13 Left 1134548981 16:15130558-15130580 CCACAGGGCCTGTAACCCGGGCA No data
Right 1134548987 16:15130594-15130616 ATGCCCTGCCCTGCCCTGCCAGG No data
1134548981_1134548990 17 Left 1134548981 16:15130558-15130580 CCACAGGGCCTGTAACCCGGGCA No data
Right 1134548990 16:15130598-15130620 CCTGCCCTGCCCTGCCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134548981 Original CRISPR TGCCCGGGTTACAGGCCCTG TGG (reversed) Intronic
No off target data available for this crispr