ID: 1134549130

View in Genome Browser
Species Human (GRCh38)
Location 16:15131159-15131181
Sequence CACCGACGGAGGCCTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134549120_1134549130 10 Left 1134549120 16:15131126-15131148 CCGCAGGGTTGCTGCTGTCCAGG No data
Right 1134549130 16:15131159-15131181 CACCGACGGAGGCCTGGGGCTGG No data
1134549123_1134549130 -8 Left 1134549123 16:15131144-15131166 CCAGGGTGACCACAGCACCGACG No data
Right 1134549130 16:15131159-15131181 CACCGACGGAGGCCTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134549130 Original CRISPR CACCGACGGAGGCCTGGGGC TGG Intronic
No off target data available for this crispr