ID: 1134551725

View in Genome Browser
Species Human (GRCh38)
Location 16:15141742-15141764
Sequence GTCCCACCCCACGGCGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134551725_1134551738 22 Left 1134551725 16:15141742-15141764 CCATCCCCGCCGTGGGGTGGGAC No data
Right 1134551738 16:15141787-15141809 CAAGAGGCCATTCACGAGACAGG No data
1134551725_1134551734 -9 Left 1134551725 16:15141742-15141764 CCATCCCCGCCGTGGGGTGGGAC No data
Right 1134551734 16:15141756-15141778 GGGTGGGACAGGGTGGCGGCTGG No data
1134551725_1134551735 -8 Left 1134551725 16:15141742-15141764 CCATCCCCGCCGTGGGGTGGGAC No data
Right 1134551735 16:15141757-15141779 GGTGGGACAGGGTGGCGGCTGGG No data
1134551725_1134551736 6 Left 1134551725 16:15141742-15141764 CCATCCCCGCCGTGGGGTGGGAC No data
Right 1134551736 16:15141771-15141793 GCGGCTGGGAGACCAGCAAGAGG No data
1134551725_1134551739 23 Left 1134551725 16:15141742-15141764 CCATCCCCGCCGTGGGGTGGGAC No data
Right 1134551739 16:15141788-15141810 AAGAGGCCATTCACGAGACAGGG No data
1134551725_1134551740 28 Left 1134551725 16:15141742-15141764 CCATCCCCGCCGTGGGGTGGGAC No data
Right 1134551740 16:15141793-15141815 GCCATTCACGAGACAGGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134551725 Original CRISPR GTCCCACCCCACGGCGGGGA TGG (reversed) Intergenic
No off target data available for this crispr