ID: 1134552884

View in Genome Browser
Species Human (GRCh38)
Location 16:15146143-15146165
Sequence CTGCCATCCTGGCCCACGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134552884_1134552887 -4 Left 1134552884 16:15146143-15146165 CCACACGTGGGCCAGGATGGCAG No data
Right 1134552887 16:15146162-15146184 GCAGAGGAGATCCACAGAGATGG No data
1134552884_1134552892 29 Left 1134552884 16:15146143-15146165 CCACACGTGGGCCAGGATGGCAG No data
Right 1134552892 16:15146195-15146217 AGGCCCTCACAGAGATGCCCTGG No data
1134552884_1134552888 6 Left 1134552884 16:15146143-15146165 CCACACGTGGGCCAGGATGGCAG No data
Right 1134552888 16:15146172-15146194 TCCACAGAGATGGCTCCAGCAGG No data
1134552884_1134552890 9 Left 1134552884 16:15146143-15146165 CCACACGTGGGCCAGGATGGCAG No data
Right 1134552890 16:15146175-15146197 ACAGAGATGGCTCCAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134552884 Original CRISPR CTGCCATCCTGGCCCACGTG TGG (reversed) Intergenic
No off target data available for this crispr