ID: 1134555165

View in Genome Browser
Species Human (GRCh38)
Location 16:15158154-15158176
Sequence CTGGAGGCAGAGGTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134555158_1134555165 -7 Left 1134555158 16:15158138-15158160 CCTTCCGCCGGCTTTCCTGGAGG No data
Right 1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134555165 Original CRISPR CTGGAGGCAGAGGTGGAGAC AGG Intergenic
No off target data available for this crispr