ID: 1134557571

View in Genome Browser
Species Human (GRCh38)
Location 16:15178898-15178920
Sequence TTGGCTCTTCACTGGCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134557571_1134557576 5 Left 1134557571 16:15178898-15178920 CCCAGATGCCAGTGAAGAGCCAA No data
Right 1134557576 16:15178926-15178948 AAAGCAAGCCTTTCTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134557571 Original CRISPR TTGGCTCTTCACTGGCATCT GGG (reversed) Intergenic
No off target data available for this crispr