ID: 1134557576

View in Genome Browser
Species Human (GRCh38)
Location 16:15178926-15178948
Sequence AAAGCAAGCCTTTCTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134557571_1134557576 5 Left 1134557571 16:15178898-15178920 CCCAGATGCCAGTGAAGAGCCAA No data
Right 1134557576 16:15178926-15178948 AAAGCAAGCCTTTCTAAAGATGG No data
1134557573_1134557576 -3 Left 1134557573 16:15178906-15178928 CCAGTGAAGAGCCAAGCCTGAAA No data
Right 1134557576 16:15178926-15178948 AAAGCAAGCCTTTCTAAAGATGG No data
1134557570_1134557576 12 Left 1134557570 16:15178891-15178913 CCAAGTTCCCAGATGCCAGTGAA No data
Right 1134557576 16:15178926-15178948 AAAGCAAGCCTTTCTAAAGATGG No data
1134557572_1134557576 4 Left 1134557572 16:15178899-15178921 CCAGATGCCAGTGAAGAGCCAAG No data
Right 1134557576 16:15178926-15178948 AAAGCAAGCCTTTCTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134557576 Original CRISPR AAAGCAAGCCTTTCTAAAGA TGG Intergenic
No off target data available for this crispr