ID: 1134567921

View in Genome Browser
Species Human (GRCh38)
Location 16:15266847-15266869
Sequence ACGCCCTACCCAAGGTCGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134567921_1134567927 16 Left 1134567921 16:15266847-15266869 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134567927 16:15266886-15266908 GTTTCCCCATCTACAAACAAGGG No data
1134567921_1134567923 -10 Left 1134567921 16:15266847-15266869 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134567923 16:15266860-15266882 GGTAGGGCGTTCCGCCACTCAGG No data
1134567921_1134567932 28 Left 1134567921 16:15266847-15266869 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134567932 16:15266898-15266920 ACAAACAAGGGGATTAGACACGG No data
1134567921_1134567928 17 Left 1134567921 16:15266847-15266869 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134567928 16:15266887-15266909 TTTCCCCATCTACAAACAAGGGG No data
1134567921_1134567926 15 Left 1134567921 16:15266847-15266869 CCATGCGACCTTGGGTAGGGCGT No data
Right 1134567926 16:15266885-15266907 AGTTTCCCCATCTACAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134567921 Original CRISPR ACGCCCTACCCAAGGTCGCA TGG (reversed) Intergenic
No off target data available for this crispr