ID: 1134570734

View in Genome Browser
Species Human (GRCh38)
Location 16:15288737-15288759
Sequence CCTCATTAGCACATGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134570734_1134570737 3 Left 1134570734 16:15288737-15288759 CCAGCATTCATGTGCTAATGAGG No data
Right 1134570737 16:15288763-15288785 ACTACTAGTATTGCAAAGATGGG No data
1134570734_1134570736 2 Left 1134570734 16:15288737-15288759 CCAGCATTCATGTGCTAATGAGG No data
Right 1134570736 16:15288762-15288784 CACTACTAGTATTGCAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134570734 Original CRISPR CCTCATTAGCACATGAATGC TGG (reversed) Intergenic
No off target data available for this crispr