ID: 1134570836

View in Genome Browser
Species Human (GRCh38)
Location 16:15289775-15289797
Sequence CAACATAAGGAAAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134570830_1134570836 16 Left 1134570830 16:15289736-15289758 CCATAGACAATGTCTCTGGGCCT No data
Right 1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG No data
1134570832_1134570836 -4 Left 1134570832 16:15289756-15289778 CCTTTTGTGGCAGAAAAACCAAC No data
Right 1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG No data
1134570827_1134570836 25 Left 1134570827 16:15289727-15289749 CCAAACGTTCCATAGACAATGTC No data
Right 1134570836 16:15289775-15289797 CAACATAAGGAAAAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134570836 Original CRISPR CAACATAAGGAAAAGAAGGC TGG Intergenic
No off target data available for this crispr