ID: 1134572825

View in Genome Browser
Species Human (GRCh38)
Location 16:15306254-15306276
Sequence CCTCATATGTGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134572825_1134572835 29 Left 1134572825 16:15306254-15306276 CCTTCCACCTTCCACATATGAGG No data
Right 1134572835 16:15306306-15306328 AAGGCACCACCTTAGAAGTAAGG No data
1134572825_1134572830 2 Left 1134572825 16:15306254-15306276 CCTTCCACCTTCCACATATGAGG No data
Right 1134572830 16:15306279-15306301 ACAGCATTCATGCCCTCCAGAGG No data
1134572825_1134572831 10 Left 1134572825 16:15306254-15306276 CCTTCCACCTTCCACATATGAGG No data
Right 1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134572825 Original CRISPR CCTCATATGTGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr