ID: 1134572831

View in Genome Browser
Species Human (GRCh38)
Location 16:15306287-15306309
Sequence CATGCCCTCCAGAGGACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134572824_1134572831 11 Left 1134572824 16:15306253-15306275 CCCTTCCACCTTCCACATATGAG No data
Right 1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG No data
1134572822_1134572831 19 Left 1134572822 16:15306245-15306267 CCCTTTTGCCCTTCCACCTTCCA No data
Right 1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG No data
1134572829_1134572831 -1 Left 1134572829 16:15306265-15306287 CCACATATGAGGATACAGCATTC No data
Right 1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG No data
1134572823_1134572831 18 Left 1134572823 16:15306246-15306268 CCTTTTGCCCTTCCACCTTCCAC 0: 5
1: 12
2: 32
3: 172
4: 951
Right 1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG No data
1134572825_1134572831 10 Left 1134572825 16:15306254-15306276 CCTTCCACCTTCCACATATGAGG No data
Right 1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG No data
1134572827_1134572831 6 Left 1134572827 16:15306258-15306280 CCACCTTCCACATATGAGGATAC No data
Right 1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG No data
1134572828_1134572831 3 Left 1134572828 16:15306261-15306283 CCTTCCACATATGAGGATACAGC No data
Right 1134572831 16:15306287-15306309 CATGCCCTCCAGAGGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134572831 Original CRISPR CATGCCCTCCAGAGGACACA AGG Intergenic
No off target data available for this crispr