ID: 1134572835

View in Genome Browser
Species Human (GRCh38)
Location 16:15306306-15306328
Sequence AAGGCACCACCTTAGAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134572824_1134572835 30 Left 1134572824 16:15306253-15306275 CCCTTCCACCTTCCACATATGAG No data
Right 1134572835 16:15306306-15306328 AAGGCACCACCTTAGAAGTAAGG No data
1134572828_1134572835 22 Left 1134572828 16:15306261-15306283 CCTTCCACATATGAGGATACAGC No data
Right 1134572835 16:15306306-15306328 AAGGCACCACCTTAGAAGTAAGG No data
1134572827_1134572835 25 Left 1134572827 16:15306258-15306280 CCACCTTCCACATATGAGGATAC No data
Right 1134572835 16:15306306-15306328 AAGGCACCACCTTAGAAGTAAGG No data
1134572833_1134572835 -9 Left 1134572833 16:15306292-15306314 CCTCCAGAGGACACAAGGCACCA No data
Right 1134572835 16:15306306-15306328 AAGGCACCACCTTAGAAGTAAGG No data
1134572832_1134572835 -8 Left 1134572832 16:15306291-15306313 CCCTCCAGAGGACACAAGGCACC No data
Right 1134572835 16:15306306-15306328 AAGGCACCACCTTAGAAGTAAGG No data
1134572829_1134572835 18 Left 1134572829 16:15306265-15306287 CCACATATGAGGATACAGCATTC No data
Right 1134572835 16:15306306-15306328 AAGGCACCACCTTAGAAGTAAGG No data
1134572825_1134572835 29 Left 1134572825 16:15306254-15306276 CCTTCCACCTTCCACATATGAGG No data
Right 1134572835 16:15306306-15306328 AAGGCACCACCTTAGAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134572835 Original CRISPR AAGGCACCACCTTAGAAGTA AGG Intergenic
No off target data available for this crispr