ID: 1134574290

View in Genome Browser
Species Human (GRCh38)
Location 16:15318807-15318829
Sequence GAGCCTTTATGGCCCTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134574290_1134574297 -1 Left 1134574290 16:15318807-15318829 CCTTATGAGGGCCATAAAGGCTC No data
Right 1134574297 16:15318829-15318851 CCAAGCTAGATGGATATTGGGGG No data
1134574290_1134574293 -4 Left 1134574290 16:15318807-15318829 CCTTATGAGGGCCATAAAGGCTC No data
Right 1134574293 16:15318826-15318848 GCTCCAAGCTAGATGGATATTGG No data
1134574290_1134574294 -3 Left 1134574290 16:15318807-15318829 CCTTATGAGGGCCATAAAGGCTC No data
Right 1134574294 16:15318827-15318849 CTCCAAGCTAGATGGATATTGGG No data
1134574290_1134574298 4 Left 1134574290 16:15318807-15318829 CCTTATGAGGGCCATAAAGGCTC No data
Right 1134574298 16:15318834-15318856 CTAGATGGATATTGGGGGAGTGG No data
1134574290_1134574299 5 Left 1134574290 16:15318807-15318829 CCTTATGAGGGCCATAAAGGCTC No data
Right 1134574299 16:15318835-15318857 TAGATGGATATTGGGGGAGTGGG No data
1134574290_1134574295 -2 Left 1134574290 16:15318807-15318829 CCTTATGAGGGCCATAAAGGCTC No data
Right 1134574295 16:15318828-15318850 TCCAAGCTAGATGGATATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134574290 Original CRISPR GAGCCTTTATGGCCCTCATA AGG (reversed) Intergenic
No off target data available for this crispr