ID: 1134588637

View in Genome Browser
Species Human (GRCh38)
Location 16:15434474-15434496
Sequence ACGGGTACCCAGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 166}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134588637_1134588644 -10 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588644 16:15434487-15434509 GGGTACCCGTAGGCGCTCCCGGG 0: 1
1: 0
2: 0
3: 0
4: 40
1134588637_1134588656 27 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588656 16:15434524-15434546 GAGGAGAGGGAGCAGCGTCACGG 0: 1
1: 0
2: 1
3: 33
4: 413
1134588637_1134588649 2 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588649 16:15434499-15434521 GCGCTCCCGGGCGCTGGCGGCGG 0: 1
1: 1
2: 9
3: 26
4: 244
1134588637_1134588648 -1 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588648 16:15434496-15434518 TAGGCGCTCCCGGGCGCTGGCGG 0: 1
1: 0
2: 0
3: 10
4: 91
1134588637_1134588647 -4 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588647 16:15434493-15434515 CCGTAGGCGCTCCCGGGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 59
1134588637_1134588655 14 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588655 16:15434511-15434533 GCTGGCGGCGGCGGAGGAGAGGG 0: 1
1: 1
2: 3
3: 132
4: 1081
1134588637_1134588657 28 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588657 16:15434525-15434547 AGGAGAGGGAGCAGCGTCACGGG 0: 1
1: 0
2: 0
3: 26
4: 274
1134588637_1134588653 8 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588653 16:15434505-15434527 CCGGGCGCTGGCGGCGGCGGAGG 0: 1
1: 6
2: 79
3: 389
4: 1826
1134588637_1134588650 5 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588650 16:15434502-15434524 CTCCCGGGCGCTGGCGGCGGCGG 0: 1
1: 4
2: 4
3: 62
4: 493
1134588637_1134588654 13 Left 1134588637 16:15434474-15434496 CCCTGCCCCTTCTGGGTACCCGT 0: 1
1: 0
2: 1
3: 8
4: 166
Right 1134588654 16:15434510-15434532 CGCTGGCGGCGGCGGAGGAGAGG 0: 1
1: 0
2: 4
3: 92
4: 775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134588637 Original CRISPR ACGGGTACCCAGAAGGGGCA GGG (reversed) Exonic
900534828 1:3171673-3171695 ACCAGAACCCAGAAGGGGCCTGG - Intronic
902994887 1:20216632-20216654 CGGGGTCCCCAGATGGGGCAGGG + Intergenic
903039070 1:20514911-20514933 ACAGGAACTCAGAAGGGACAAGG + Intergenic
904809067 1:33151501-33151523 AAAGGGACCTAGAAGGGGCATGG + Intronic
906383807 1:45349767-45349789 ACAGGTACCCAGAAGGAGCTTGG + Intronic
906555712 1:46711322-46711344 TCAGGTACCCCGAAGGGGCAAGG + Intronic
910935790 1:92484042-92484064 TCGAGGACCCGGAAGGGGCAAGG + Intronic
915164779 1:153942376-153942398 GGGGGTACCCAAAAGGAGCAGGG + Intronic
915631737 1:157157954-157157976 ACTGGGACCCAGCAGGGGGATGG - Intergenic
918003801 1:180523295-180523317 ACCAGTAGCCAGAAGAGGCAAGG + Intergenic
920756452 1:208738385-208738407 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
922728966 1:227940229-227940251 CCTGGACCCCAGAAGGGGCATGG + Intronic
922744525 1:228036783-228036805 ACAGGTACAGAGAAAGGGCAGGG + Intronic
923252676 1:232191852-232191874 AGGGGAAGCCAGAAGGGGGATGG - Intergenic
924772488 1:247089467-247089489 GGGGGCACCCAGAAGGGGCCCGG + Intergenic
1063991962 10:11576266-11576288 GAGTGTACCCAGAAGAGGCATGG + Intronic
1065835759 10:29656657-29656679 ACAGGAACTCAGAAGGGGCTTGG - Intronic
1066182346 10:32975474-32975496 ATAGGAACTCAGAAGGGGCAAGG - Intronic
1067258559 10:44666501-44666523 CTGGGTCCCCAGAAGGGCCATGG + Intergenic
1072930242 10:99656225-99656247 AGGGGCACTCAGGAGGGGCATGG + Intergenic
1074508913 10:114095441-114095463 AAGGGTAACCAAAATGGGCAGGG + Intergenic
1083159494 11:60846176-60846198 ACGAGAACCCTGAAGGGACAAGG - Intronic
1084219866 11:67671239-67671261 ACGACTGCCCAGAAAGGGCAGGG - Intronic
1087140015 11:94756013-94756035 ACGGGAAACCAGAAAGGGGATGG + Intronic
1091816102 12:3439339-3439361 ACCGGTACCCAGGAGAGACAGGG - Intronic
1095953683 12:47795094-47795116 AGGGGTACTTAGAAAGGGCAGGG - Intronic
1098943814 12:76567985-76568007 ACTGGTACCCAGAAGTGATATGG + Intergenic
1098991136 12:77065753-77065775 CCAGGTACCCGGAAGGGGGAGGG - Intergenic
1102931793 12:116867951-116867973 AAAGGTACCCAGGAGGGGCTGGG + Intronic
1104611083 12:130228338-130228360 ACAGGAACCCAGGAGGGGCAAGG + Intergenic
1107583294 13:41815575-41815597 ACCAAAACCCAGAAGGGGCAAGG + Intronic
1110484264 13:76019768-76019790 ATGGGGACCCAGAAGGGGCATGG + Intergenic
1111206720 13:85020445-85020467 ATGGGTAGCCAGAAGGAGGAGGG - Intergenic
1111262489 13:85760395-85760417 ATGGGGAGCCAGAAGGGGTATGG + Intergenic
1111413810 13:87912463-87912485 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1112463749 13:99625216-99625238 CCAGGTTCCCAGAAGGGACAGGG - Intronic
1112929240 13:104714023-104714045 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1115159766 14:30380675-30380697 ACGGGCAGCGAGAAGGGGCAAGG + Intergenic
1117920369 14:60721997-60722019 ACAGGGGCCCAGAAGCGGCAAGG + Intronic
1120978949 14:90274200-90274222 ACGGGGACTCAGCATGGGCAGGG + Exonic
1121159668 14:91726059-91726081 ATGGCTACCTAGAAGGGGGATGG - Intronic
1121183780 14:91948978-91949000 ACCAGCACCCAGAAGGGGCTGGG - Intergenic
1121458720 14:94056492-94056514 TGGTGTACCCAGGAGGGGCATGG + Intronic
1121529859 14:94644654-94644676 ACGGATCCCCAGAACAGGCAAGG + Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122440806 14:101730692-101730714 AAGGGTACCCAGGTGGGGCCTGG + Intronic
1125893297 15:43281836-43281858 ACAAGTACCCAGAAGGTGCTGGG - Exonic
1129410845 15:75349426-75349448 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1130073751 15:80671052-80671074 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1134378721 16:13703964-13703986 AGGGGTACCCCTAAGGGTCATGG + Intergenic
1134588637 16:15434474-15434496 ACGGGTACCCAGAAGGGGCAGGG - Exonic
1136599971 16:31278551-31278573 ACAGGTACTGAGCAGGGGCATGG - Intronic
1139284455 16:65798071-65798093 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1140748141 16:77999146-77999168 ATGGGCAGCCAGAAGGGGGATGG + Intergenic
1144320844 17:14117926-14117948 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1144545210 17:16188526-16188548 ACGTGAACCCAGGAGGGGGAGGG + Intronic
1144956420 17:19021074-19021096 ACGGCTACCTAGGTGGGGCACGG - Exonic
1145785132 17:27588577-27588599 GCTGGTACCCAGATGGGGCCAGG + Intronic
1148813927 17:50313176-50313198 AGGGATACCAACAAGGGGCAGGG + Intergenic
1149085461 17:52710296-52710318 ATGGGCCCCCAGAAGAGGCATGG - Intergenic
1150999025 17:70352137-70352159 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1152543956 17:80991678-80991700 ACCGGTACGGAGAAGTGGCACGG - Intronic
1153998005 18:10458528-10458550 ACCTGTACCCAACAGGGGCAAGG + Intronic
1159417604 18:68173259-68173281 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1160187581 18:76687594-76687616 ACAGGCACACAGAAGGGGCAGGG + Intergenic
1160857710 19:1224765-1224787 AGGAGTACCCAGCAGGGGGAAGG + Intronic
1161857759 19:6775465-6775487 ACGGGAACCCAGATGGGGTCAGG + Intronic
1167414080 19:49361388-49361410 ACGGAGACCTAGAAAGGGCAGGG + Exonic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
925092509 2:1166946-1166968 ATGGAGAGCCAGAAGGGGCATGG - Intronic
929792572 2:45034437-45034459 AAAGATACCAAGAAGGGGCAAGG - Intergenic
931262788 2:60634788-60634810 GCAGGTACCCAGAAGGGGCTAGG + Intergenic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933010442 2:77055324-77055346 ACGTGTGCCCAGAAAGAGCAAGG - Intronic
934119900 2:88828689-88828711 TCAGTTACCCAGCAGGGGCATGG + Intergenic
934794691 2:97090594-97090616 CGGGGTAACCAGAAGGGGAAAGG - Intronic
935138819 2:100333142-100333164 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
937245306 2:120488686-120488708 CCGGGTACCTAGAGGAGGCAAGG + Intergenic
937508898 2:122570722-122570744 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
937509344 2:122576187-122576209 ATGGCTTCCCAGAAGGGGTAAGG + Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
940856474 2:158732258-158732280 AGGGGCATTCAGAAGGGGCATGG - Intergenic
942222503 2:173784239-173784261 ACGGGAACTCAGCAGGGGGATGG + Intergenic
947047358 2:226003154-226003176 AAAGGTATCCAGAGGGGGCATGG + Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1171451423 20:25238592-25238614 ACCGGTTCAGAGAAGGGGCAAGG + Intergenic
1172130269 20:32650584-32650606 AGGGATGCCCAGAATGGGCACGG - Intergenic
1173413791 20:42838390-42838412 AAGGGTACCCAGAGGGGCAAGGG - Intronic
1173871254 20:46343554-46343576 AGGGATTCCCAGATGGGGCAAGG - Intergenic
1175451470 20:59072408-59072430 ACTGGGAGCCAGAAGAGGCAAGG + Intergenic
1178357356 21:31920073-31920095 ACTGGAAGCCAGAAGAGGCAGGG - Intronic
1178422361 21:32452707-32452729 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1180062243 21:45391416-45391438 ACGGGGACCCAGAGGATGCACGG + Intergenic
1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG + Intronic
1182880081 22:33725501-33725523 ACTGGTAATCAAAAGGGGCAGGG + Intronic
1183040693 22:35175623-35175645 ACAAGGACTCAGAAGGGGCAAGG + Intergenic
1183854834 22:40624566-40624588 ATAAGTACCCAGAAGAGGCAGGG + Intronic
1183897796 22:40983109-40983131 AGGGTAACCCAGAAGGGCCACGG - Intergenic
949530475 3:4950449-4950471 ACGGGAACCCAGTTGGTGCATGG + Intergenic
950652247 3:14414461-14414483 AGCTGTCCCCAGAAGGGGCATGG + Intronic
953662493 3:44901359-44901381 TGGGGTGCCCAGAAGGGCCAAGG - Intronic
954687867 3:52380297-52380319 ACCGGTACCCAGAGAGAGCAAGG - Intronic
955328385 3:58027050-58027072 ACGGGTCTCCAGAAGGGGAGTGG - Intronic
956181141 3:66519145-66519167 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
958001956 3:87761837-87761859 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960501609 3:118445051-118445073 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
960573182 3:119205516-119205538 ACAGGTACCCGGTGGGGGCATGG - Intergenic
961880221 3:130056495-130056517 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
965185275 3:165454898-165454920 ACTGGGAGCCAGAAGGGGGATGG + Intergenic
968647080 4:1746473-1746495 ACGGGTGCCAAGAAGCCGCATGG + Intergenic
968992610 4:3924850-3924872 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
969292290 4:6247779-6247801 ACAGGTGCCCAGAGGGGGAAAGG + Intergenic
969471038 4:7389462-7389484 ACGAGTACACAGATGGGGCGGGG + Intronic
969507204 4:7595475-7595497 ATTGGTACCCAGAAGGACCAAGG - Intronic
969822741 4:9732772-9732794 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
969877965 4:10149920-10149942 AGGGGTCCCCAGGAGGCGCAAGG - Intergenic
970493100 4:16596021-16596043 ACTGCAACCCAGAAGGGTCATGG - Intronic
971362440 4:25950533-25950555 GCAGGAAGCCAGAAGGGGCATGG + Intergenic
978414784 4:108463778-108463800 ATGGGGAGCCAGAAGGGGTATGG - Intergenic
984520533 4:180796374-180796396 ATGGGTAACTAGAAGGGGGATGG + Intergenic
987005705 5:13707253-13707275 ATGGGGAGCCAGAAGGGGGATGG - Intronic
987212137 5:15693838-15693860 ATGGGGAGCCAGAAGGGGGATGG - Intronic
989256233 5:39368538-39368560 AAGGCTACACAGAAGAGGCAGGG + Intronic
989517886 5:42364420-42364442 CTGCCTACCCAGAAGGGGCAAGG - Intergenic
990630004 5:57658519-57658541 ACGGTTACCCAAAACCGGCAAGG - Intergenic
992672752 5:79076138-79076160 ATGGGGAGCCAGAAGGGGGATGG + Intronic
1000658892 5:163915412-163915434 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1006139568 6:31920318-31920340 ACTGGTACCCAGAACTGGGAAGG + Intronic
1006333002 6:33405518-33405540 ACTGGAACCCGGAAGGGTCAAGG + Exonic
1006787742 6:36679530-36679552 ACGGAGACCGCGAAGGGGCAGGG - Intronic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1017614370 6:156229018-156229040 AAGGGGCCCCAAAAGGGGCATGG - Intergenic
1017980135 6:159394173-159394195 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1018723455 6:166591622-166591644 ACCAGAAACCAGAAGGGGCAAGG + Intronic
1020138470 7:5599277-5599299 AGGGGTTCCAAGAAGGGGCGGGG + Intronic
1020315256 7:6901206-6901228 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1022992760 7:35724910-35724932 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1026111066 7:67459302-67459324 ATGGGGATCCAGAAGGGGGATGG + Intergenic
1026272018 7:68844936-68844958 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1028187163 7:87800499-87800521 TCAGGTACCCAGAAGTGGGATGG + Intronic
1029611601 7:101629567-101629589 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1030436146 7:109523227-109523249 ACGGGTTTCCAAAAGGGGGAAGG + Intergenic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1035311174 7:157969945-157969967 ACGGGATCCCTGAAGGTGCAGGG + Intronic
1035375017 7:158402039-158402061 ACCGGTGCCCAGCAGGGTCAGGG + Intronic
1036101017 8:5785222-5785244 ATGTGTACCCAGAAGTGGGATGG + Intergenic
1038266211 8:26041522-26041544 ACGGAGACCCGGAAAGGGCAAGG + Intronic
1039524329 8:38200295-38200317 AAGGGTACCCAGGCTGGGCACGG - Intronic
1041552749 8:59119471-59119493 GCGGGGATCCAGAAGGGACAGGG + Intergenic
1044206203 8:89494331-89494353 ACGGGGAGCCAGAAGGGAGATGG - Intergenic
1048123507 8:131607786-131607808 ACAGGGAGCCAGAAGGGGAATGG + Intergenic
1049344808 8:142133177-142133199 ACGGGAACCCAGAGGAGCCAGGG - Intergenic
1051471039 9:17442479-17442501 ACTTGAACCCAGAAGGTGCAGGG - Intronic
1053198927 9:36139628-36139650 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1055189804 9:73504233-73504255 ACAGGAACTAAGAAGGGGCAAGG - Intergenic
1055189847 9:73504735-73504757 ACAGGAACTAAGAAGGGGCAAGG - Intergenic
1056072517 9:83003226-83003248 ACACACACCCAGAAGGGGCATGG + Intronic
1056871905 9:90289626-90289648 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1057942677 9:99298621-99298643 ATGGGTACTCAGAAGGGCCCGGG - Intergenic
1058236598 9:102498123-102498145 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1059406044 9:114098716-114098738 GCGGGCACTCAGAAGGGGCGGGG + Intronic
1061590196 9:131593135-131593157 CCGGGTACCAAGGAGAGGCATGG + Intronic
1062481465 9:136754431-136754453 CAGGGTGCCCAGGAGGGGCAGGG + Exonic
1062571420 9:137187431-137187453 GCGGGGAACCAGAAGGAGCAAGG + Intronic
1185498364 X:576887-576909 ATGGACACCCAGAAGAGGCAGGG + Intergenic
1187097280 X:16161906-16161928 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1187138524 X:16571154-16571176 ATGGGGAGCCAGAAGGGGGATGG - Intergenic
1189578902 X:42384833-42384855 ACTGTTACCCAGAAGGAGAAAGG - Intergenic
1189656817 X:43253205-43253227 TTGGGTACCTAGAATGGGCAAGG - Intergenic
1191974902 X:66861309-66861331 ATGGGGAGCCAGAAGGGGGATGG + Intergenic
1193511046 X:82400171-82400193 ACTGGAAGCCAGAAGGGGCACGG + Intergenic
1200163951 X:154023433-154023455 ACGGGAGCCCAGCATGGGCAAGG + Intronic
1201563959 Y:15346856-15346878 TCAGGTACCCAGAGAGGGCAGGG + Intergenic
1202117356 Y:21482454-21482476 ATGGGGACCCAGAAGGGAAATGG - Intergenic