ID: 1134588673

View in Genome Browser
Species Human (GRCh38)
Location 16:15434591-15434613
Sequence CCTGCAGCCCGCAACGGGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134588660_1134588673 17 Left 1134588660 16:15434551-15434573 CCGGCCCGTTAAAACGCTGCTGG 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1134588673 16:15434591-15434613 CCTGCAGCCCGCAACGGGAATGG 0: 1
1: 0
2: 1
3: 5
4: 83
1134588662_1134588673 13 Left 1134588662 16:15434555-15434577 CCCGTTAAAACGCTGCTGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1134588673 16:15434591-15434613 CCTGCAGCCCGCAACGGGAATGG 0: 1
1: 0
2: 1
3: 5
4: 83
1134588664_1134588673 12 Left 1134588664 16:15434556-15434578 CCGTTAAAACGCTGCTGGCTGGA 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1134588673 16:15434591-15434613 CCTGCAGCCCGCAACGGGAATGG 0: 1
1: 0
2: 1
3: 5
4: 83
1134588659_1134588673 18 Left 1134588659 16:15434550-15434572 CCCGGCCCGTTAAAACGCTGCTG 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1134588673 16:15434591-15434613 CCTGCAGCCCGCAACGGGAATGG 0: 1
1: 0
2: 1
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134588673 Original CRISPR CCTGCAGCCCGCAACGGGAA TGG Exonic
900476511 1:2878780-2878802 CCTTCAGCCCCCAAGGGGACAGG + Intergenic
900666802 1:3820964-3820986 CCTGCAGCTCAGAACGGGAAGGG + Intronic
901036448 1:6338873-6338895 CCTGCAGCGCCCAGTGGGAAGGG + Intronic
906078286 1:43067999-43068021 TCTGGAGCCCACACCGGGAATGG + Intergenic
908851704 1:68383304-68383326 CCTGCAACCTGCAACCTGAAAGG - Intergenic
916024016 1:160818701-160818723 ACTGCAGCCCGCTGAGGGAAGGG + Intronic
921866725 1:220094299-220094321 CCTGCAGCCCGGGATGGCAAGGG + Exonic
922216869 1:223526942-223526964 CCTGAAGTCTGCAACGGGCAAGG - Intergenic
1067696771 10:48541576-48541598 CCTGGAGCCCCCAAAGGCAATGG + Intronic
1070562504 10:77578502-77578524 CCTGCAGCCCCCAACGAGGGAGG + Intronic
1071682367 10:87718929-87718951 CCTGCAGCTTGGAAGGGGAAAGG - Intronic
1076206884 10:128610784-128610806 CCTGCAGGCAGCCACGGGCATGG + Intergenic
1076917236 10:133430382-133430404 CCTGCAGCTCTAAAGGGGAAGGG + Intergenic
1076937333 10:133575141-133575163 CCTGCAGCTCTAAAGGGGAAGGG + Intergenic
1083277710 11:61606574-61606596 CCTGCAGCCCCCAGTGGGCACGG - Intergenic
1084406870 11:68979339-68979361 CCTCCAGGCCGCACTGGGAAGGG - Intergenic
1090307243 11:125702136-125702158 CCTGCAGCCTGCAGCCTGAAAGG - Intergenic
1090313456 11:125764032-125764054 CCAGCAGCCTGCAGTGGGAAGGG - Intergenic
1092210111 12:6640311-6640333 CCGGCAGCCCGCAGTGGGAAAGG - Intronic
1101970734 12:109310109-109310131 CCTGGAGCCAGCCGCGGGAAAGG + Intergenic
1110982603 13:81919938-81919960 CCTGCCACCGGCACCGGGAAAGG - Intergenic
1112299709 13:98218671-98218693 CCTGCGGCCCGCAACTGGCATGG - Intronic
1113804268 13:113104228-113104250 CCTGGAGCCCCAAAGGGGAAGGG + Intergenic
1121758339 14:96421934-96421956 CCAGCAGCCCGCAATGCAAAGGG + Intronic
1122404610 14:101492779-101492801 CCTGCTGCCCTGAACAGGAAGGG + Intergenic
1122770254 14:104094677-104094699 CCGGCAGCCCTCACCGGGCAAGG + Intronic
1127262595 15:57337149-57337171 CCTGTAGCCCGATATGGGAAGGG - Intergenic
1128306065 15:66599842-66599864 CCTGCTGCCCATAACGGGAAGGG - Intronic
1134588673 16:15434591-15434613 CCTGCAGCCCGCAACGGGAATGG + Exonic
1138270388 16:55691854-55691876 CCACCAGCCCGCCACGGGATTGG + Intronic
1139484597 16:67248652-67248674 GGGGCAGCCCGCAGCGGGAAGGG - Intronic
1140468892 16:75203996-75204018 ACTGCAGCCTGGAAAGGGAACGG + Intergenic
1141535039 16:84673293-84673315 CCTGCTGCCATCAACAGGAAGGG - Intergenic
1144942051 17:18948598-18948620 CCTGAAGCCCTCAAGGGGAGTGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1150070953 17:62149371-62149393 ACTGCAGCCTGCTAGGGGAAAGG + Intergenic
1151058222 17:71058811-71058833 CCTGCAGCCAGGAAGGTGAAGGG - Intergenic
1154030153 18:10746452-10746474 CCTTCAGCCTGCACTGGGAATGG + Intronic
1155573851 18:27224029-27224051 CCTGCAGCCTGCAGCTTGAAAGG + Intergenic
1160423628 18:78766078-78766100 CCTGAAGCCAGCAACGGGAAGGG + Intergenic
1160441923 18:78899551-78899573 CCTGGAGCCCGCAGGGGGAGGGG - Intergenic
1160988637 19:1851728-1851750 CCTGCTGCCCGCCCGGGGAAGGG - Intergenic
925441934 2:3895463-3895485 CATGCAGCCTGCAACTTGAAAGG + Intergenic
926799861 2:16650717-16650739 CCTGCAACCGGCACCGGGAATGG + Intronic
927870499 2:26619959-26619981 CCTGAAGCCCACAGCGGGGAAGG + Intronic
928376295 2:30777404-30777426 CCTGCAGCCTGCAATGAGCAGGG - Intronic
933634882 2:84698031-84698053 CCTTCAGCCCGCCACAGGTAGGG - Intronic
936802985 2:116289033-116289055 CCAGCAGCCCGCAACGCAATGGG - Intergenic
938236572 2:129710819-129710841 CCTGCAGCCCAGAATGGGGAGGG - Intergenic
944148649 2:196533529-196533551 CCTGCAGCCTGCAAACTGAAGGG - Intronic
947579865 2:231308406-231308428 CCTGCAGGCTGCAGCGGGAGTGG + Intronic
1172240366 20:33408873-33408895 CCTGCAGCCTGCACGTGGAATGG - Exonic
1173953124 20:47008743-47008765 CTTGCAGCCTGCAACAGGCAAGG - Intronic
1174357903 20:50010335-50010357 CCTGCCGCCCCAAAAGGGAAGGG - Intergenic
1175282724 20:57814842-57814864 CCTGCATCCCCCACTGGGAAAGG + Intergenic
1179304456 21:40141764-40141786 GCTGCAGCCCCCAGCAGGAAAGG - Intronic
1181697530 22:24601479-24601501 CCTGCAGCCTGAGAGGGGAAGGG - Intronic
1183617302 22:38953591-38953613 CCTGCTGCCTGCATCAGGAAGGG + Intronic
1185326164 22:50226842-50226864 CCTGCAGACCGCAAAGGGGGTGG + Exonic
949599290 3:5580860-5580882 CCTGCAGCCCAGCACAGGAAAGG - Intergenic
950722957 3:14897917-14897939 CCTGCAGCCAGGAATGGGGATGG - Exonic
962317888 3:134370120-134370142 TCTGCAGCCTGCAGTGGGAAAGG - Intronic
962520946 3:136196729-136196751 CCTGCAGCCCACACTGGGGAAGG - Intronic
962859781 3:139389268-139389290 CCTGCAGTCTGCAGCGGGATCGG - Intronic
963603817 3:147397680-147397702 CCTGCAGCCTGCAAGAGGAGGGG + Intronic
965127919 3:164653572-164653594 CCTGCATCCAGAAATGGGAAGGG + Intergenic
967231188 3:187338857-187338879 CCTGCAGCTTGCGAAGGGAAAGG - Intergenic
969972090 4:11058320-11058342 CTTGGAGCCAGCAATGGGAATGG - Intergenic
978170072 4:105659170-105659192 CCTGCAGCGATCAACGGGAGAGG + Exonic
984781348 4:183529000-183529022 CCAACAGACTGCAACGGGAATGG + Intergenic
985606981 5:863051-863073 CCTGCAGGCAGCCACTGGAACGG + Intronic
989711204 5:44399481-44399503 CCTGCAGCATGCAAATGGAAGGG + Intergenic
991684219 5:69167053-69167075 CCGGCAGCCGCCAATGGGAAGGG + Exonic
995527728 5:113064025-113064047 GCTGCAGCCGGCCACGGCAAAGG + Exonic
997984427 5:138491816-138491838 CCTGCAGCCTGCAACTGCGAGGG + Intergenic
998018448 5:138751427-138751449 CCTGCAGCCAGAAACAGGACAGG + Intronic
999682480 5:154073009-154073031 CCAGCAGCCCGCAATGCGACGGG + Intronic
1000359382 5:160433250-160433272 TCTGCAGCCCTCAAAGGGGATGG - Intergenic
1002279023 5:178120205-178120227 CCTACGGCGGGCAACGGGAAAGG + Exonic
1002296372 5:178233311-178233333 CCTGAAGCCCAGAAAGGGAAAGG + Intergenic
1003107895 6:3229302-3229324 CCTCCACCCCACAGCGGGAAAGG - Intronic
1024775252 7:52777384-52777406 CCAGCAGCCTGCAACTGGCATGG + Intergenic
1028826194 7:95276236-95276258 CCTGCAGCCAGAAAGGGGGAGGG + Intronic
1029918044 7:104231925-104231947 CCTTCCACCCGCAACAGGAACGG + Intergenic
1049819048 8:144623040-144623062 CATGCAGGCTGCAACGGGGAGGG + Intergenic
1062457525 9:136646614-136646636 CCTGCAGGCCGGAGCAGGAAGGG - Intergenic
1188004478 X:25007507-25007529 CCCGCAGCGCGCCAAGGGAAGGG - Intronic
1198308172 X:135403014-135403036 GCTGCAGCCTGCAGTGGGAAAGG + Intergenic
1199255953 X:145719193-145719215 CCTGCAGCCAGGAAAGGCAATGG - Intergenic
1199575729 X:149312025-149312047 CCCGCAGCCCTAAAAGGGAAAGG - Intergenic