ID: 1134589640

View in Genome Browser
Species Human (GRCh38)
Location 16:15442032-15442054
Sequence AAGACTTAGGAGAGGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134589632_1134589640 13 Left 1134589632 16:15441996-15442018 CCATGGGTTGTCCTCTGGAAGAT No data
Right 1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG No data
1134589633_1134589640 2 Left 1134589633 16:15442007-15442029 CCTCTGGAAGATCAAGCACCTGG No data
Right 1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG No data
1134589631_1134589640 14 Left 1134589631 16:15441995-15442017 CCCATGGGTTGTCCTCTGGAAGA 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG No data
1134589630_1134589640 15 Left 1134589630 16:15441994-15442016 CCCCATGGGTTGTCCTCTGGAAG No data
Right 1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134589640 Original CRISPR AAGACTTAGGAGAGGGAGGC CGG Intronic
No off target data available for this crispr