ID: 1134592164

View in Genome Browser
Species Human (GRCh38)
Location 16:15463392-15463414
Sequence GATGCCTTCAAGCGTATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134592164_1134592168 12 Left 1134592164 16:15463392-15463414 CCTGAAATACGCTTGAAGGCATC No data
Right 1134592168 16:15463427-15463449 GTTATCACAGAAGTGTGGTCAGG No data
1134592164_1134592167 7 Left 1134592164 16:15463392-15463414 CCTGAAATACGCTTGAAGGCATC No data
Right 1134592167 16:15463422-15463444 CCACTGTTATCACAGAAGTGTGG No data
1134592164_1134592169 22 Left 1134592164 16:15463392-15463414 CCTGAAATACGCTTGAAGGCATC No data
Right 1134592169 16:15463437-15463459 AAGTGTGGTCAGGTTCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134592164 Original CRISPR GATGCCTTCAAGCGTATTTC AGG (reversed) Intronic
No off target data available for this crispr