ID: 1134598967

View in Genome Browser
Species Human (GRCh38)
Location 16:15518551-15518573
Sequence TGGCTCAAAGCCTGTTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134598967_1134598973 4 Left 1134598967 16:15518551-15518573 CCAGGCCAACAGGCTTTGAGCCA No data
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
1134598967_1134598974 21 Left 1134598967 16:15518551-15518573 CCAGGCCAACAGGCTTTGAGCCA No data
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134598967 Original CRISPR TGGCTCAAAGCCTGTTGGCC TGG (reversed) Intronic
No off target data available for this crispr