ID: 1134598969

View in Genome Browser
Species Human (GRCh38)
Location 16:15518556-15518578
Sequence GGCCTTGGCTCAAAGCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134598969_1134598973 -1 Left 1134598969 16:15518556-15518578 CCAACAGGCTTTGAGCCAAGGCC 0: 1
1: 0
2: 2
3: 7
4: 136
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
1134598969_1134598974 16 Left 1134598969 16:15518556-15518578 CCAACAGGCTTTGAGCCAAGGCC 0: 1
1: 0
2: 2
3: 7
4: 136
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134598969 Original CRISPR GGCCTTGGCTCAAAGCCTGT TGG (reversed) Intronic
900587202 1:3438982-3439004 AGCCTTGGGGCAAGGCCTGTGGG - Intergenic
901385895 1:8908993-8909015 GGCCTTGGCTCAAAAACTGGAGG - Intergenic
903568277 1:24285196-24285218 GGCCTTGGCCCAAACCTTATTGG - Intergenic
904130656 1:28273033-28273055 GCCATAGGCTCAAAGCCTGTTGG + Intronic
904255482 1:29251850-29251872 GGCCTTGGCTAAGAGCCTTAGGG + Intronic
905206827 1:36347331-36347353 GTCCTTGGCCCAAATCCTTTAGG - Intronic
905439733 1:37987379-37987401 GGCCTTGGCTTAAAAGCTGAGGG + Intronic
905901107 1:41582468-41582490 GTCCTTGGCTGGAAGCCCGTGGG + Exonic
906392601 1:45431866-45431888 GGGTTTGGCTCAAGGCCTGGTGG + Intronic
914961657 1:152214407-152214429 GGCCGTGGCCCAAAGACTGACGG + Exonic
914961906 1:152215817-152215839 GGCCGTGGCCCAAAGACTGACGG + Exonic
914962151 1:152217227-152217249 GGCCGTGGCCCAAAGACTGACGG + Exonic
914962402 1:152218637-152218659 GGCCGTGGCCCAAAGACTGACGG + Exonic
914962762 1:152220737-152220759 GGCCGTGGCCCAAAGACTGACGG + Exonic
919828389 1:201520361-201520383 GGCCTTGGCCTAAAGTCTGGAGG + Intergenic
920175561 1:204099380-204099402 TGCCTGGGCTCAAATCATGTTGG + Intronic
1063062184 10:2567610-2567632 GGTCTGAGCTCACAGCCTGTGGG + Intergenic
1063075610 10:2713366-2713388 GGCCCTGGCTTAAACCGTGTGGG + Intergenic
1067546024 10:47193223-47193245 GGCCTTGGCACACAGCGTGAGGG + Intergenic
1070289511 10:75105278-75105300 TGCCTCAGCTGAAAGCCTGTGGG - Intronic
1070772126 10:79088603-79088625 AGCCTCTGCTTAAAGCCTGTAGG - Intronic
1071140823 10:82507452-82507474 GGCTTTGCCTCCAAGCCTGAAGG + Intronic
1075086403 10:119417091-119417113 GGCCTTGGCTGAATGCGTGGAGG + Intronic
1075512253 10:123082031-123082053 GAGCTTGGCTCCAGGCCTGTGGG + Intergenic
1078976463 11:16484016-16484038 GGGCTTGGCCCAGGGCCTGTCGG + Intronic
1081672921 11:44951476-44951498 GGCCTAGGCTGGAAGCCTGAAGG - Intergenic
1081788868 11:45768529-45768551 GGCCTGGGGTCAATGCCTGAGGG + Intergenic
1082010805 11:47448651-47448673 GGCCCTGGCTGCCAGCCTGTGGG + Intronic
1083326058 11:61873620-61873642 GGCCTTGGCTCTGGGCCTGATGG - Exonic
1083627627 11:64079638-64079660 GCCCCTCACTCAAAGCCTGTGGG + Intronic
1089089066 11:115851356-115851378 GGCCTTGACTGAAAGTCTATGGG - Intergenic
1089702794 11:120255478-120255500 ATCCCTGCCTCAAAGCCTGTTGG + Intronic
1089817255 11:121187408-121187430 GCCCCTGACTCAAACCCTGTTGG - Intronic
1091160403 11:133414633-133414655 GGCTTCGTCTCAAAGCCTGCGGG - Intronic
1091657541 12:2356526-2356548 GCCCTTGGCCCCAAGGCTGTGGG + Intronic
1092017968 12:5175299-5175321 GGCCTTTGCCCAAAGACTGAAGG - Intergenic
1094132639 12:27091048-27091070 GGGCTTGGCCCAAAGTATGTAGG - Intergenic
1096627008 12:52902110-52902132 GGCCAGGGCTCAAAGTCTGGAGG + Intronic
1096974683 12:55693302-55693324 GGCCTTGGTTGGAAACCTGTGGG + Exonic
1106993514 13:35452578-35452600 GACCTTGGCTCTTAGCATGTTGG - Intronic
1110441017 13:75525248-75525270 GGCCCTGGCTCAAACACTGTGGG - Intronic
1116302517 14:43202840-43202862 GGCCTTGGCTCACAGACCTTTGG + Intergenic
1118478089 14:66137280-66137302 GGCCTGAGCCCAAAGCCTCTTGG - Intergenic
1119473864 14:74915954-74915976 GGCCTGGCCTCAGAGCCTGGGGG - Intronic
1120356322 14:83438870-83438892 GGCCTTGGCCCACAGACTGAAGG + Intergenic
1121855526 14:97266003-97266025 GGACTTGGCTTTAAGGCTGTTGG - Intergenic
1125534012 15:40432627-40432649 GGCTGTGGCTGAGAGCCTGTAGG + Intronic
1125599139 15:40906244-40906266 GGCTTTGGCCCTAAGCCTGGAGG + Intergenic
1127464370 15:59229276-59229298 GGCCTGGGCTGACAGCATGTTGG - Intronic
1128224629 15:65993364-65993386 GGCCTTCATTAAAAGCCTGTGGG - Intronic
1131119339 15:89813335-89813357 GGCCTTAGCTTAAAGGCTGTAGG + Intronic
1131976821 15:97955242-97955264 GCCCTTGGTTCAAAGCCAGGAGG - Intergenic
1133056059 16:3145971-3145993 GGCCTTGGATCACAGCCAGGAGG - Exonic
1134598969 16:15518556-15518578 GGCCTTGGCTCAAAGCCTGTTGG - Intronic
1139267925 16:65657121-65657143 GGTCTTGGATCAAAGCCAGGTGG - Intergenic
1141072630 16:80972077-80972099 GGCCTGGGCTAGAGGCCTGTGGG - Exonic
1141949317 16:87330539-87330561 GGCCTTGGCTCCAAAGCTGGAGG + Exonic
1142134203 16:88444194-88444216 GCCCTTGGGTCTCAGCCTGTGGG + Intergenic
1144706498 17:17371784-17371806 GGCCTTGGCTCTCAGCTTCTGGG + Intergenic
1145004381 17:19329144-19329166 GCCCTGGGCCCACAGCCTGTGGG + Intronic
1146603860 17:34241247-34241269 GGCCTTGGCTTTCTGCCTGTAGG + Intergenic
1147119320 17:38326604-38326626 GTCCTTGGCTCAAGCCCTGAAGG + Exonic
1152449158 17:80365480-80365502 GGCCTGGCGTCACAGCCTGTGGG + Intronic
1152573346 17:81129964-81129986 GGCCTTGGCTCCAAAGCTGGGGG + Intronic
1156430267 18:37065259-37065281 GGCCTTGAATGAAAGCCTGAGGG + Intronic
1156881744 18:42088375-42088397 GGCCATGCCTTAAAGCCTGGAGG - Intergenic
1157164748 18:45348162-45348184 TGCACTGGCTCAAAGCCTGCAGG + Intronic
1157599765 18:48886796-48886818 GGCTTTGGCTCAATGACTCTAGG - Intergenic
1157819266 18:50753538-50753560 GGCCTTGGCTCAGAGGCTTGGGG + Intergenic
1160505947 18:79426960-79426982 GTCCTTGGCTTGAAGCCTGCCGG + Intronic
1161392915 19:4030821-4030843 GGCCTGGGCCCCAAGCATGTGGG - Intronic
1161637641 19:5399105-5399127 GGGCCTGGCTCACAGCATGTGGG - Intergenic
1163126422 19:15246656-15246678 GGCCTCTGCTCACAGCCTGCAGG - Intronic
1165825272 19:38702294-38702316 GGCCTTGGAACAAAGCCTAATGG + Intronic
925679999 2:6410433-6410455 TGCCTTGGTACAAAGTCTGTGGG + Intergenic
926606570 2:14904332-14904354 GGCCTTGGGTCACAGACTGAAGG - Intergenic
928596564 2:32864524-32864546 GGCCTTAGCTCAGAGCCTTCTGG - Intergenic
929955203 2:46452743-46452765 GACCTTGGATCAAAGCCTCTGGG - Intronic
931780595 2:65576311-65576333 GGCCTTTGCTCAGTGACTGTGGG + Intergenic
932227309 2:70052800-70052822 GGCCTTGCTTCAAATCCTGCAGG - Intergenic
932408757 2:71532474-71532496 GGCCCTGGCTGAGTGCCTGTGGG + Intronic
932564427 2:72896597-72896619 GGTGTTGGCACAAAGCCTGGAGG + Intergenic
933966592 2:87434855-87434877 GGCCTTGGCTCAAAGGCTGAGGG + Intergenic
935624060 2:105154339-105154361 ATCTTTGGCTCAAGGCCTGTGGG + Intergenic
936327201 2:111515629-111515651 GGCCTTGGCTCAAAGGCTGAGGG - Intergenic
936937625 2:117853449-117853471 GGCCTTGGCTCATCACCTCTAGG + Intergenic
937980286 2:127610732-127610754 GGACTTAGCTCAATACCTGTGGG + Intronic
946472888 2:219979193-219979215 GGCCTTGGCTAAAATCCACTTGG - Intergenic
1168766129 20:382339-382361 GGCCATCCCTCAGAGCCTGTTGG - Intronic
1168897377 20:1333082-1333104 GGCCTTGGCTCTGAACCTCTAGG + Intronic
1173945643 20:46948365-46948387 GGGTTTGGCTCATAGGCTGTGGG + Intronic
1182882432 22:33745059-33745081 GGAATTGCCTCAAAGCCTGAAGG + Intronic
1184335250 22:43849055-43849077 GGACTTGGGTCGAGGCCTGTGGG + Intronic
1185274506 22:49944516-49944538 GGCCTGGGGACCAAGCCTGTGGG + Intergenic
1185340398 22:50288345-50288367 GGCCTGGGCCCCAAGCTTGTGGG - Intronic
951181852 3:19668488-19668510 GAGCTGGGCTCAAAGCCAGTGGG + Intergenic
952809015 3:37384977-37384999 AACCTTGGCTCTAAGTCTGTTGG + Intergenic
953033724 3:39193726-39193748 GGCCCAGGCTCCATGCCTGTGGG + Intergenic
954672030 3:52296362-52296384 AGCCCTGGCTCAAACACTGTTGG + Intergenic
954700899 3:52450465-52450487 GCCCTTGGCTGGAAGCCAGTTGG + Intergenic
961990628 3:131186400-131186422 GGCCTTGGCTCTAATTCTGGGGG - Intronic
963007656 3:140741044-140741066 GGCCTCAGCTCAAAACCTATTGG + Intergenic
966936112 3:184710958-184710980 GGCCTTGGCTCTGGCCCTGTCGG + Exonic
968596471 4:1488614-1488636 GGCCTGGGCTCCTAGCCTGTGGG + Intergenic
968971019 4:3793909-3793931 GGCAGTGGCTCTGAGCCTGTGGG + Intergenic
973659489 4:53088347-53088369 GGCTTAGGCTCCAAGCCTTTTGG - Intronic
973714466 4:53661614-53661636 GGCCTTTGTTCAAAGCCAGGAGG + Intronic
990766598 5:59190725-59190747 GGCCTTCTCTTAAACCCTGTTGG - Intronic
1017034570 6:150255795-150255817 GGCCTGGGCTCCAAGGCTCTGGG - Intergenic
1018294312 6:162329264-162329286 GACCTTGGCTCAAGGACTGCTGG - Intronic
1018723970 6:166596582-166596604 GGCCTTCGCTCACAGACTGAAGG + Intronic
1019904370 7:4049470-4049492 GGCCTGGGTTCAGGGCCTGTGGG + Intronic
1026744077 7:72997693-72997715 GGCCTTGGCACAGTGCCTGGGGG - Intergenic
1026804325 7:73420314-73420336 GGCCTTGGCACAGTGCCTGGTGG - Intergenic
1027030183 7:74882370-74882392 GGCCTTGGCACAGTGCCTGGGGG - Intergenic
1027099660 7:75367399-75367421 GGCCTTGGCACAGTGCCTGGGGG + Intergenic
1029117563 7:98245091-98245113 GGCCTTGGACCCAAGCCTGCTGG + Intronic
1029306665 7:99624729-99624751 GACCTGGGCTCAGAGCCTGGGGG + Intronic
1029813843 7:103074765-103074787 GGCCATGGCCCAAGGCCTGACGG + Intronic
1034938153 7:155212877-155212899 AGCCGTGGCTCACAGCCTCTAGG + Intergenic
1040967822 8:53101907-53101929 GGCCATCGCTCAAACCCTATAGG + Intergenic
1041943590 8:63416937-63416959 AGCCTTGGCTCAAAGTAGGTTGG + Intergenic
1043643938 8:82493254-82493276 GGCCTTTCCTCAAAGCCTTGCGG + Intergenic
1046101677 8:109621619-109621641 GGCCTGGGTACAATGCCTGTGGG - Intronic
1048142845 8:131811528-131811550 AGCCTTGGCTCAAGGACAGTTGG + Intergenic
1048952151 8:139505182-139505204 GATCCTGGCTCCAAGCCTGTTGG + Intergenic
1049581311 8:143412393-143412415 TGCCTTGGCTCCCAGCCTGCCGG - Intergenic
1050850695 9:10282013-10282035 AGCCTTTGATGAAAGCCTGTAGG + Intronic
1057559517 9:96116298-96116320 AGCCCTGGGTCAAAGCCTGCAGG - Exonic
1057567471 9:96178334-96178356 GGCCTTGGCGCCAGGCCGGTGGG - Intergenic
1060434355 9:123580935-123580957 TGCCTTGCCTGAAATCCTGTAGG - Intronic
1060603006 9:124890424-124890446 GGCCATGGCTCAAGCCCTGGAGG - Exonic
1061245843 9:129400997-129401019 GGCCTGGGCTCCAACCCTGCGGG + Intergenic
1061991928 9:134163849-134163871 GGGCCTGGTTCAAAGCCTGACGG - Intergenic
1062368117 9:136221638-136221660 GGCCCTGGCTCTCAGCCCGTGGG - Intronic
1062443901 9:136585436-136585458 GGCCTTGGCTGGAACCCTGGGGG - Intergenic
1186584462 X:10857632-10857654 GTCCTTCTCTCAAAGCCTCTTGG + Intergenic
1189905800 X:45758324-45758346 TGCTTTTCCTCAAAGCCTGTAGG - Intergenic
1192161377 X:68790639-68790661 GGGCTTGTCTCAGGGCCTGTGGG + Intergenic
1192185655 X:68945179-68945201 GGCCCTGGCTCAGAGGCTGGTGG - Intergenic
1192315396 X:70047658-70047680 GGCCTTCTCTCAAGGCCTTTAGG + Intronic
1194511477 X:94801262-94801284 GGGATTGGCTCAAAGCCAGTAGG - Intergenic
1195160097 X:102162520-102162542 AGCCTTGGCTCAAAGGCTCCAGG - Intergenic
1195162700 X:102186048-102186070 GTCCTTAGCTGAATGCCTGTTGG - Intergenic
1195166761 X:102227650-102227672 GTCCTTAGCTGAATGCCTGTTGG - Intergenic
1195192099 X:102459438-102459460 GTCCTTAGCTGAATGCCTGTTGG + Intronic