ID: 1134598972

View in Genome Browser
Species Human (GRCh38)
Location 16:15518578-15518600
Sequence CCAAGAAAGTGAATTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134598972_1134598977 13 Left 1134598972 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
Right 1134598977 16:15518614-15518636 ATGGTTTTTCCCGAAGCTGTGGG No data
1134598972_1134598974 -6 Left 1134598972 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data
1134598972_1134598976 12 Left 1134598972 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
Right 1134598976 16:15518613-15518635 GATGGTTTTTCCCGAAGCTGTGG No data
1134598972_1134598978 14 Left 1134598972 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
Right 1134598978 16:15518615-15518637 TGGTTTTTCCCGAAGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134598972 Original CRISPR CCAAGAAAGTGAATTCAAGC AGG (reversed) Intronic
No off target data available for this crispr