ID: 1134598973

View in Genome Browser
Species Human (GRCh38)
Location 16:15518578-15518600
Sequence CCTGCTTGAATTCACTTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134598962_1134598973 21 Left 1134598962 16:15518534-15518556 CCATCATCCTCAGCCCTCCAGGC 0: 1
1: 1
2: 6
3: 75
4: 608
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
1134598965_1134598973 8 Left 1134598965 16:15518547-15518569 CCCTCCAGGCCAACAGGCTTTGA No data
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
1134598967_1134598973 4 Left 1134598967 16:15518551-15518573 CCAGGCCAACAGGCTTTGAGCCA No data
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
1134598966_1134598973 7 Left 1134598966 16:15518548-15518570 CCTCCAGGCCAACAGGCTTTGAG No data
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
1134598960_1134598973 27 Left 1134598960 16:15518528-15518550 CCTCATCCATCATCCTCAGCCCT No data
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
1134598963_1134598973 14 Left 1134598963 16:15518541-15518563 CCTCAGCCCTCCAGGCCAACAGG No data
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
1134598969_1134598973 -1 Left 1134598969 16:15518556-15518578 CCAACAGGCTTTGAGCCAAGGCC 0: 1
1: 0
2: 2
3: 7
4: 136
Right 1134598973 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134598973 Original CRISPR CCTGCTTGAATTCACTTTCT TGG Intronic
No off target data available for this crispr