ID: 1134598974

View in Genome Browser
Species Human (GRCh38)
Location 16:15518595-15518617
Sequence TCTTGGCTGTTCCTCAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134598972_1134598974 -6 Left 1134598972 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data
1134598971_1134598974 -5 Left 1134598971 16:15518577-15518599 CCCTGCTTGAATTCACTTTCTTG No data
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data
1134598967_1134598974 21 Left 1134598967 16:15518551-15518573 CCAGGCCAACAGGCTTTGAGCCA No data
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data
1134598969_1134598974 16 Left 1134598969 16:15518556-15518578 CCAACAGGCTTTGAGCCAAGGCC 0: 1
1: 0
2: 2
3: 7
4: 136
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data
1134598970_1134598974 1 Left 1134598970 16:15518571-15518593 CCAAGGCCCTGCTTGAATTCACT No data
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data
1134598965_1134598974 25 Left 1134598965 16:15518547-15518569 CCCTCCAGGCCAACAGGCTTTGA No data
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data
1134598966_1134598974 24 Left 1134598966 16:15518548-15518570 CCTCCAGGCCAACAGGCTTTGAG No data
Right 1134598974 16:15518595-15518617 TCTTGGCTGTTCCTCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134598974 Original CRISPR TCTTGGCTGTTCCTCAGAGA TGG Intronic
No off target data available for this crispr