ID: 1134598976

View in Genome Browser
Species Human (GRCh38)
Location 16:15518613-15518635
Sequence GATGGTTTTTCCCGAAGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134598970_1134598976 19 Left 1134598970 16:15518571-15518593 CCAAGGCCCTGCTTGAATTCACT No data
Right 1134598976 16:15518613-15518635 GATGGTTTTTCCCGAAGCTGTGG No data
1134598971_1134598976 13 Left 1134598971 16:15518577-15518599 CCCTGCTTGAATTCACTTTCTTG No data
Right 1134598976 16:15518613-15518635 GATGGTTTTTCCCGAAGCTGTGG No data
1134598972_1134598976 12 Left 1134598972 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
Right 1134598976 16:15518613-15518635 GATGGTTTTTCCCGAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134598976 Original CRISPR GATGGTTTTTCCCGAAGCTG TGG Intronic
No off target data available for this crispr