ID: 1134598977

View in Genome Browser
Species Human (GRCh38)
Location 16:15518614-15518636
Sequence ATGGTTTTTCCCGAAGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134598972_1134598977 13 Left 1134598972 16:15518578-15518600 CCTGCTTGAATTCACTTTCTTGG No data
Right 1134598977 16:15518614-15518636 ATGGTTTTTCCCGAAGCTGTGGG No data
1134598971_1134598977 14 Left 1134598971 16:15518577-15518599 CCCTGCTTGAATTCACTTTCTTG No data
Right 1134598977 16:15518614-15518636 ATGGTTTTTCCCGAAGCTGTGGG No data
1134598970_1134598977 20 Left 1134598970 16:15518571-15518593 CCAAGGCCCTGCTTGAATTCACT No data
Right 1134598977 16:15518614-15518636 ATGGTTTTTCCCGAAGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134598977 Original CRISPR ATGGTTTTTCCCGAAGCTGT GGG Intronic
No off target data available for this crispr