ID: 1134599384

View in Genome Browser
Species Human (GRCh38)
Location 16:15521515-15521537
Sequence TTCAGGGCAAGTGGGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134599384_1134599389 -9 Left 1134599384 16:15521515-15521537 CCAGGACACCCACTTGCCCTGAA No data
Right 1134599389 16:15521529-15521551 TGCCCTGAATCAGGCCCAGGAGG No data
1134599384_1134599395 30 Left 1134599384 16:15521515-15521537 CCAGGACACCCACTTGCCCTGAA No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134599384 Original CRISPR TTCAGGGCAAGTGGGTGTCC TGG (reversed) Intronic