ID: 1134599386

View in Genome Browser
Species Human (GRCh38)
Location 16:15521523-15521545
Sequence GGGCCTGATTCAGGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134599386_1134599397 26 Left 1134599386 16:15521523-15521545 CCCACTTGCCCTGAATCAGGCCC No data
Right 1134599397 16:15521572-15521594 TAAGTGAGCTCCCAGCAGGCAGG No data
1134599386_1134599395 22 Left 1134599386 16:15521523-15521545 CCCACTTGCCCTGAATCAGGCCC No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134599386 Original CRISPR GGGCCTGATTCAGGGCAAGT GGG (reversed) Intronic