ID: 1134599387

View in Genome Browser
Species Human (GRCh38)
Location 16:15521524-15521546
Sequence TGGGCCTGATTCAGGGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134599387_1134599397 25 Left 1134599387 16:15521524-15521546 CCACTTGCCCTGAATCAGGCCCA No data
Right 1134599397 16:15521572-15521594 TAAGTGAGCTCCCAGCAGGCAGG No data
1134599387_1134599395 21 Left 1134599387 16:15521524-15521546 CCACTTGCCCTGAATCAGGCCCA No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134599387 Original CRISPR TGGGCCTGATTCAGGGCAAG TGG (reversed) Intronic