ID: 1134599387 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:15521524-15521546 |
| Sequence | TGGGCCTGATTCAGGGCAAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1134599387_1134599397 | 25 | Left | 1134599387 | 16:15521524-15521546 | CCACTTGCCCTGAATCAGGCCCA | No data | ||
| Right | 1134599397 | 16:15521572-15521594 | TAAGTGAGCTCCCAGCAGGCAGG | No data | ||||
| 1134599387_1134599395 | 21 | Left | 1134599387 | 16:15521524-15521546 | CCACTTGCCCTGAATCAGGCCCA | No data | ||
| Right | 1134599395 | 16:15521568-15521590 | GCCATAAGTGAGCTCCCAGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1134599387 | Original CRISPR | TGGGCCTGATTCAGGGCAAG TGG (reversed) | Intronic | ||