ID: 1134599389

View in Genome Browser
Species Human (GRCh38)
Location 16:15521529-15521551
Sequence TGCCCTGAATCAGGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134599379_1134599389 1 Left 1134599379 16:15521505-15521527 CCACCCCAACCCAGGACACCCAC No data
Right 1134599389 16:15521529-15521551 TGCCCTGAATCAGGCCCAGGAGG No data
1134599383_1134599389 -8 Left 1134599383 16:15521514-15521536 CCCAGGACACCCACTTGCCCTGA No data
Right 1134599389 16:15521529-15521551 TGCCCTGAATCAGGCCCAGGAGG No data
1134599381_1134599389 -3 Left 1134599381 16:15521509-15521531 CCCAACCCAGGACACCCACTTGC 0: 1
1: 0
2: 1
3: 20
4: 231
Right 1134599389 16:15521529-15521551 TGCCCTGAATCAGGCCCAGGAGG No data
1134599382_1134599389 -4 Left 1134599382 16:15521510-15521532 CCAACCCAGGACACCCACTTGCC No data
Right 1134599389 16:15521529-15521551 TGCCCTGAATCAGGCCCAGGAGG No data
1134599384_1134599389 -9 Left 1134599384 16:15521515-15521537 CCAGGACACCCACTTGCCCTGAA No data
Right 1134599389 16:15521529-15521551 TGCCCTGAATCAGGCCCAGGAGG No data
1134599380_1134599389 -2 Left 1134599380 16:15521508-15521530 CCCCAACCCAGGACACCCACTTG No data
Right 1134599389 16:15521529-15521551 TGCCCTGAATCAGGCCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134599389 Original CRISPR TGCCCTGAATCAGGCCCAGG AGG Intronic