ID: 1134599395

View in Genome Browser
Species Human (GRCh38)
Location 16:15521568-15521590
Sequence GCCATAAGTGAGCTCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134599391_1134599395 13 Left 1134599391 16:15521532-15521554 CCTGAATCAGGCCCAGGAGGTCA No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data
1134599392_1134599395 2 Left 1134599392 16:15521543-15521565 CCCAGGAGGTCAAGTTCACAGAC No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data
1134599390_1134599395 14 Left 1134599390 16:15521531-15521553 CCCTGAATCAGGCCCAGGAGGTC No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data
1134599393_1134599395 1 Left 1134599393 16:15521544-15521566 CCAGGAGGTCAAGTTCACAGACC No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data
1134599386_1134599395 22 Left 1134599386 16:15521523-15521545 CCCACTTGCCCTGAATCAGGCCC No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data
1134599384_1134599395 30 Left 1134599384 16:15521515-15521537 CCAGGACACCCACTTGCCCTGAA No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data
1134599387_1134599395 21 Left 1134599387 16:15521524-15521546 CCACTTGCCCTGAATCAGGCCCA No data
Right 1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134599395 Original CRISPR GCCATAAGTGAGCTCCCAGC AGG Intronic
No off target data available for this crispr