ID: 1134599397

View in Genome Browser
Species Human (GRCh38)
Location 16:15521572-15521594
Sequence TAAGTGAGCTCCCAGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134599392_1134599397 6 Left 1134599392 16:15521543-15521565 CCCAGGAGGTCAAGTTCACAGAC No data
Right 1134599397 16:15521572-15521594 TAAGTGAGCTCCCAGCAGGCAGG No data
1134599391_1134599397 17 Left 1134599391 16:15521532-15521554 CCTGAATCAGGCCCAGGAGGTCA No data
Right 1134599397 16:15521572-15521594 TAAGTGAGCTCCCAGCAGGCAGG No data
1134599387_1134599397 25 Left 1134599387 16:15521524-15521546 CCACTTGCCCTGAATCAGGCCCA No data
Right 1134599397 16:15521572-15521594 TAAGTGAGCTCCCAGCAGGCAGG No data
1134599390_1134599397 18 Left 1134599390 16:15521531-15521553 CCCTGAATCAGGCCCAGGAGGTC No data
Right 1134599397 16:15521572-15521594 TAAGTGAGCTCCCAGCAGGCAGG No data
1134599393_1134599397 5 Left 1134599393 16:15521544-15521566 CCAGGAGGTCAAGTTCACAGACC No data
Right 1134599397 16:15521572-15521594 TAAGTGAGCTCCCAGCAGGCAGG No data
1134599386_1134599397 26 Left 1134599386 16:15521523-15521545 CCCACTTGCCCTGAATCAGGCCC No data
Right 1134599397 16:15521572-15521594 TAAGTGAGCTCCCAGCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134599397 Original CRISPR TAAGTGAGCTCCCAGCAGGC AGG Intronic